... works through transduction of Cas9-expressing (Rosa26-Cas9) hematopoietic stem cells with a lentiviral...of genes pXPR_219 Violet-excited GFP (vex) Rosa26-Cas9 I-CHIME Inducible knockout of a single...single gene pXPR_068 Violet-excited GFP (vex) Rosa26-FlpO-ERT2; H11-Cas9 L-CHIME Knocks out a ...pXPR_070 Violet-excited GFP (vex) Lineage-Cre; Rosa26-Cas9 S-CHIME Knocks out pairs of genes sequentially...sequentially pXPR_220 Violet-excited GFP (vex) Rosa26-FlpO-ERT2; H11-Cas9 Table 1: X-CHIME systems...

...GMAP-compatible backbone containing Rosa26 homology arms. The Rosa26 locus is commonly used to drive ubiquitous...target a CAG-driven loxP-stop-loxP cassette into the Rosa26 locus, allowing for Cre-dependent expression of...

...mouse contains the Brainbow 2.1 construct in the Rosa26 locus, under a loxP “roadblock” so that XFP are...

...Cre-ERT2 with loxp cassette; Targeting vector for Rosa26 locus Mammalian Jacks 12238 pLOX-CW-CRE Cre CMV...Neo and stop cassette; Contains flanking arms for Rosa26 integration; See similar plasmid 11739 Mouse Targeting...EGFP-dsRed gene switch plasmid Mammalian Green 22799 Ai9 Rosa26 targeting vector, Cre dependent tdtomato expression...Cre-dependent Cas9 can be knocked in to a mouse at the Rosa26 locus to facilitate Cas9 mediated genome editing...

...described below: 61408 : Targeting vector for the mouse Rosa26 locus; Used to make Cas9 knockin mouse Vectors ...

...stem (ES) cells. These vectors, termed RUSH (For ROSA26 U6 short hairpin) and CRUSH (Conditional RUSH) ...

...GTGAGACGTCAACAATATGG 59930 cut S. pyogenes 25161212 Fire Rosa26 M.musculus ACTCCAGTCTTTCTAGAAGA 64216 cut S. pyogenes...