Skip to main content
Addgene

We narrowed to 7 results for: rosa26

Showing: 1 - 7 of 7 results
  1. X-CHIME: Context Dependent Germline Knockout in Immune Cells

    Type
    Blog Post
    ... works through transduction of Cas9-expressing (Rosa26-Cas9) hematopoietic stem cells with a lentiviral...of genes pXPR_219 Violet-excited GFP (vex) Rosa26-Cas9 I-CHIME Inducible knockout of a single...single gene pXPR_068 Violet-excited GFP (vex) Rosa26-FlpO-ERT2; H11-Cas9 L-CHIME Knocks out a ...pXPR_070 Violet-excited GFP (vex) Lineage-Cre; Rosa26-Cas9 S-CHIME Knocks out pairs of genes sequentially...sequentially pXPR_220 Violet-excited GFP (vex) Rosa26-FlpO-ERT2; H11-Cas9 Table 1: X-CHIME systems...
  2. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...GMAP-compatible backbone containing Rosa26 homology arms. The Rosa26 locus is commonly used to drive ubiquitous...target a CAG-driven loxP-stop-loxP cassette into the Rosa26 locus, allowing for Cre-dependent expression of...
  3. Cre-lox system

    Type
    Collection
    ...Cre-ERT2 with loxp cassette; Targeting vector for Rosa26 locus Mammalian Jacks 12238 pLOX-CW-CRE Cre CMV...Neo and stop cassette; Contains flanking arms for Rosa26 integration; See similar plasmid 11739 Mouse Targeting...EGFP-dsRed gene switch plasmid Mammalian Green 22799 Ai9 Rosa26 targeting vector, Cre dependent tdtomato expression...Cre-dependent Cas9 can be knocked in to a mouse at the Rosa26 locus to facilitate Cas9 mediated genome editing...
  4. Zhang Lab CRISPR Page

    Type
    Collection
    ...described below: 61408 : Targeting vector for the mouse Rosa26 locus; Used to make Cas9 knockin mouse Vectors ...
  5. Validated gRNA Sequences

    Type
    Collection
    ...GTGAGACGTCAACAATATGG 59930 cut S. pyogenes 25161212 Fire Rosa26 M.musculus ACTCCAGTCTTTCTAGAAGA 64216 cut S. pyogenes...
Showing: 1 - 7 of 7 results