Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 1,045 results for: sta

Showing: 161 - 180 of 1045 results

  1. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...as NEB Stable cells. These strains reduce the frequency of homologous recombination of unstable regions...overcome this obstacle, has been to use smaller Cas9 orthologs, such as SaCas9 from Staphylococcus aureus ....into the transfer plasmid can be done with most standard cloning methods, including restriction enzyme,...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...AAVs cannot enter the lytic cycle, and instead establish latent infections by integrating into the host...years without damaging the host cell. Episomal stability allows for long-term transgene expression in non-dividing...well characterized and are often preferred over standard rAAV vectors for in vivo applications. Other Engineered...

  2. Promoters

    Type
    Guide
    ... the start codon and contains the RNA polymerase binding site, TATA box, and transcription start site ...factors bind. Distal Promoter The final portion of the promoter region is called the distal promoter which...located within promoter regions, and they provide a stable binding site for RNA polymerase and transcription...promoter: core promoter, proximal promoter, and distal promoter. Below describes the specifics of these...polymerase will bind to this core promoter region stably and transcription of the template strand can initiate...transcription. The most 3' portion (closest to the gene's start codon) of the core promoter is the TSS which is ...which is upstream of the proximal promoter. The distal promoter also contains transcription factor binding...

  3. Adenovirus Guide

    Type
    Guide
    ...as NEB Stable cells. These strains reduce the frequency of homologous recombination of unstable regions...transcripts are expressed after DNA replication starts and primarily encode for structural proteins needed...remain the most popular choice due to their well-established methods, relative simplicity of production, and...into the transfer plasmid can be done with most standard cloning methods, including restriction enzyme,...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...adenoviral backbone plasmid. One can also co-transform standard BJ5183 with supercoiled pAdEasy and the shuttle...candidates for multiple infectious diseases and prostate cancer. Cancer Treatment Recombinant adenoviral...

  4. Plan Your Experiment

    Type
    Guide
    ...Once you have a clear understanding of your experimental goal, you are ready to start navigating the different...generate stable cell lines (for details, see Plasmids 101: Mammalian Vectors ) Transient or stable expression...Expression System Design gRNA Publications Get Started CRISPR is a powerful system that enables researchers...section will provide a general framework to get you started using CRISPR in your research. Although we will...cell types (e.g. HEK293 cells), transfection with standard transfection reagents may be sufficient to express...details about lentivirus, see our Lentivirus Guide ) Stable, tunable expression of Cas9 and/or gRNA in a wide...compatible with smaller Cas enzymes) Transient or stable expression of SaCas9 and/or gRNA Infects dividing...

  5. Sequencing Primers

    Type
    Guide
    ...neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene, ...Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG...Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA...

  6. Optogenetics Guide

    Type
    Guide
    ...control molecular signals and cells in order to understand their functions. Example schematic of an optogenetics...the brain and nervous system to better map and understand neuronal circuits. Optogenetic tools have also...disorder research, helping scientists to better understand Parkinson’s disease, depression, drug addiction...photocurrents 470 SFO/SSFO Step function Opsins and Stabilized Step Function Opsins. Mutations at C128 and D156...to “long lasting,” e.g. seconds to minutes with stable step-function opsins (SSFOs). Opsin delivery systems...opsin expression. Generally, the most robust and stable expression is achieved in a transgenic mouse line...

  7. Guide to Using Pooled Libraries

    Type
    Guide
    ...CRISPR libraries include: resistance to the anti-cancer drug vemurafenib , resistance to Clostridium septicum... A well-designed screen can help you begin to understand what genes are important to a certain phenotype...septicum alpha-toxin , and resistance to to the nucleotide analog 6-thioguanine . Next-generation sequencing...

  8. Cloning

    Type
    Guide
    ...dsDNA at a specified distance away from the recognition sequence. Cutting distal to their recognition ...This may be due to speed, cost, availability of starting materials or just personal preference. Check out... fragments you want to assemble before you get started. Check out Addgene's website for easy to use MoClo...

  9. Plasmids 101: Gram Negative and Positive Bacteria

    Type
    Blog Post
    ...chemistry behind Gram’s crystal violet stain and the ion interactions that cause the stain retention in gram...positive bacteria trap the crystal violet stain within their membrane, while the stain is washed from the gram...realized that certain stains were retained only in some species of bacteria. The stain colored one type, ...Gram’s discovery, adding a second stain, safranin, as a counterstain to help visualize the bleached bacteria...Procedure The stain is a pretty simple process. First, flood the heat-fixed smear with the crystal violet stain... bacteria will be stained blue or purple, and gram negative bacteria will be stained red or pink, as shown...mixing the stains and solutions used, check out these resources.   Bruckner, M. Gram Staining. https://...

  10. CRISPR Antimicrobials

    Type
    Blog Post
    ...without a resistance gene, allowing resistant bacteria to multiply, spreading their resistance genes throughout...antibiotic resistance is upon us, and the world is unprepared. Each year in the United States, two million...antibiotic resistant bacteria. Even when researchers develop new antibiotics, the onset of resistance is swift...antibiotic resistant bacteria with a weapon that they’ll have less potential to become resistant to? CRISPR...or antibiotic resistant bacteria, and inappropriate antibiotic usage selects for resistant bacteria, allowing...propagate their resistance genes. Our society is hoping to combat antibiotic resistance using multiple ...development of resistance will be slow. CRISPR may be just the method needed to jumpstart the fight against...

  11. Antibodies 101: Flow Cytometry

    Type
    Blog Post
    ...Direct staining is quicker than indirect staining and eliminates potential non-specific staining that may...its native state.  Antibodies-based flow cytometry can use both direct and indirect staining methods. In...intracellular staining where binding of large immune complexes may be hindered. Indirect staining can be beneficial...fixation. If staining both cell surface and intracellular proteins in parallel, then stain the surface ... non-specific staining.  If you’re using antibodies for detection, include an unstained control with cells...cells that went through the staining procedure minus the antibody. An unstained control allows you to detect...-specific staining associated with the primary antibody. When following an indirect staining protocol,...

  12. Illuminating Choices: A Guide to Selecting Fluorescent Dyes and Ligands

    Type
    Blog Post
    ... electrons are elevated from a ground state to an excited state through the absorption of photons. After... elevation in this excited state, the electron returns to its ground state by emitting a photon with slightly...lengths of time, the stability of fluorescence over time is crucial. For instance, the fluorescence of...toxicity and high photostability is crucial. These properties ensure a more consistent and stable signal over...Fluorescence refers to the emission of light by a substance (fluorophore) that has absorbed light or electromagnetic...al., 2014). Other dyes may prove challenging to stain intracellular compartments in in vivo model systems...so extra care must be taken to assess if proper staining is achieved. Fluorescent ligands have more flexibility...

  13. Antibodies 101: Isotypes

    Type
    Blog Post
    ...which heavy chain constant domain it pairs with its variable chain domain. B cells start by co-expressing...expressed with the IgM and IgD constant domains because they are the first constant domain genes in the cluster...heavy-chain constant genes μ and ẟ. These are the first two genes in the heavy-chain constant domain gene...heavy-chain constant domain genes, placing the variable domain genes next to a different constant domain gene... antibody that’s determined by its heavy-chain constant region (see Antibodies 101: Introduction to Antibodies...antibody isotypes that each have a unique heavy-chain constant region: IgM, IgD, IgG, IgE, and IgA.    ...labeled with Fc, Fab, heavy chain, light chain, constant region, and variable region.   Why are antibody...

  14. RANbodies: Reporter Nanobody Fusions

    Type
    Blog Post
    ...reporter. The only caveat is that HA staining is weaker than reporter staining. Picking the right reporter for... them. HRP RANbody staining results in a ≥10-fold increase in signal over staining with a primary/ labeled...antigen with a standard primary/labeled secondary Less sensitive than HRP-RANbody staining Requires secondary... IgY antibody Staining cultured cells and tissue sections Great for multicolor staining of tissue since...antigen with standard primary/labeled secondary   Less sensitive than HRP-RANbody staining Requires secondary...secondary antibody staining GFP, RFP, H2A2B   Are you ready to start making your own RANbodies? Great...tissues. Although antibody production is well established, it’s also a process that’s difficult for individual...

  15. Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins

    Type
    Blog Post
    ...photoswitched from a dark state to a bright fluorescent state (“kindling”), and from a bright state to a dark non-...be activated from low fluorescent states to high fluorescence states, they can change from one fluorescent...switched on from a state of dim or no fluorescence, to a brighter fluorescent state by exposure to a specific...Padron is photoconverted from a dark state, to an activated state, emitting bright green fluorescence.... and ability to switch from a dark state to a red fluorescent state make them useful for 2-color imaging...parameters to consider, such as brightness, photostability, pH stability, chromophore maturation rate at 37 °... monomeric) and display bright and photostable green and red states. Beyond these imaging applications...

  16. New Tool for Lineage Tracing: The ClonTracer Library

    Type
    Blog Post
    ...cancer development, metastasis, and drug resistance, Bhang says “the [drug] resistance story panned out ...Using ClonTracer to study drug resistance Although Bhang and co-workers started using the tool to look at ...cells that represent the preexisting resistant subpopulation 2. Resistant cells among the separate replicates...majority of the resistant populations. In fact, 88% of the barcodes within the resistant populations were... populations with resistance to both drugs. The future of ClonTracer Since starting her new role as an...determine whether or not cancer cell populations resistant to drug treatments arise during treatment or are...preexisting in the parent population prior to the start of treatment. They hypothesized that, if they labeled...

  17. Deep Dive: qPCR

    Type
    Blog Post
    ...Amplification Efficacy Assumptions Standard Curve Yes Standard Curve No experimental sample variation...variation ΔΔCT No Standard Curve reference=target Pfaffl et al No Standard Curve sample=control...deep dive series, which aims to increase your understanding and technical proficiency with common applications...in protein expression. (If you're just getting started, check out our Introduction to PCR.) But if you're...you're ready to go beyond the 101 and take your understanding to the next level, read on for more in-depth... differences of twofold or greater with good statistical significance (Taylor, 2017). With the right conditions...sometimes cause as many issues as it solves, so understanding and using the application correctly is imperative...

  18. Antibodies 101: The Basics of Western Blotting

    Type
    Blog Post
    ...improve resolution, use a stacking gel on top of the resolving gel. A stacking gel typically has a different...antibodies used for staining. To address this, the membranes are incubated before staining in a buffer containing...separated in a gel, transferred to a membrane, stained with antibodies, and finally visualized.   ...modifications, quantify protein levels relative to standards, detect the cellular location of proteins, and...acrylamide. In addition to the samples, a protein standard of known molecular weight in a separate lane can...separate by size. Smaller proteins encounter less resistance in the acrylamide matrix and migrate faster through...percentage of acrylamide to increase migration resistance and improve separation. For large proteins, reduce...

  19. Advice on Career Paths and the Green Card Process for International Researchers and Entrepreneurs

    Type
    Blog Post
    ...the following paths to maintaining a status in the United States including green cards that are well-tailored...relied upon for legal advice in any particular circumstance or fact situation.  The information presented...looking to continue their careers in the United States. There has been a growing shift away from employers...with filing a permanent residence case with United States Citizenship and Immigration Services (USCIS). If...with working with US immigration in its current state. As of September 2017, USCIS received 116,224 employment...government sectors.  Within these sectors, you could start your own company, work in a bench research career...plan for and develop your career into a series of stages to refine and build skills overtime for success...

  20. A Control for All Seasons

    Type
    Blog Post
    ... gold standard to demonstrate primary antibody specificity. B, secondary antibody-only staining will allow...Such species-on-species staining can be partially addressed with stringent staining protocols and the use...omitted from the staining but all secondary antibodies are included. If, for instance, you omitted a mouse...and outs of controls for biological experiments, starting with general controls and then moving on to controls...applications. After reading, you will have a better understanding of the different types of controls and be able...groups were run on a western against a protein standard (P) to check for tau molecular weight shifts. ...the precision and accuracy and therefore the statistical power of an experiment. Technical replicates ...
Showing: 161 - 180 of 1045 results