... the constant region, and is shown in dark blue and dark orange. The constant region is a stable part ...antibody’s constant region - specifically, it is determined by a region called the “heavy chain constant region...techniques use a nuclear stain, such as DAPI, to identify individual cells. These stains also emit fluorescent...sequencing, and enables the variable region and constant regions of the antibody to be independently manipulated...Structure Figure 1: Structure of an antibody A standard antibody is made up of four protein chains: two...responsible for producing antibodies, can change the constant region, and therefore change the isotype of antibodies...capable of recognizing and binding epitopes on constant regions of other antibodies. This has useful research...

...From an experimental standpoint the main difference between lentiviruses and standard retroviruses (γ-retroviruses...homologous recombination of unstable regions, such as Invitrogen Stbl3™ or NEB Stable cells. This will ensure...lentivirus be used to make stable cell lines? Lentiviruses can be used to make stable cell lines in the same...as the puromycin resistance gene, conferring antibiotic resistance to infected host cells. When these ...non-dividing and actively dividing cell types whereas standard retroviruses can only infect mitotically active...types than retroviruses. Both lentiviruses and standard retroviruses use the gag, pol, and env genes for...same manner as standard retroviruses. That is, many lentiviral genomes have selectable markers, such as...

...used to install the LSR Bxb1’s landing site into the genome at a desired locus, then Bxb1 installs the donor...including resistances to chemotherapy drugs and toxins, cell viability, and tumor metastasis. One of the...genome-wide screens. This guide will provide a basic understanding of CRISPR biology, introduce the various applications...applications of CRISPR, and help you get started using CRISPR in your own research. CRISPR Basics In this...target cleavage, while mismatches toward the 5′ end distal to the PAM often permit target cleavage. Generating... Cas9 orthologs are available. SaCas9 (from Staphylococcus aureus ) has a coding sequence ~1 kb shorter...addition of a structured motif to enhance pegRNA stability PEmax - optimized PE architecture; increased synergy...

... the start codon and contains the RNA polymerase binding site, TATA box, and transcription start site ...factors bind. Distal Promoter The final portion of the promoter region is called the distal promoter which...located within promoter regions, and they provide a stable binding site for RNA polymerase and transcription...promoter: core promoter, proximal promoter, and distal promoter. Below describes the specifics of these...polymerase will bind to this core promoter region stably and transcription of the template strand can initiate...transcription. The most 3' portion (closest to the gene's start codon) of the core promoter is the TSS which is ...which is upstream of the proximal promoter. The distal promoter also contains transcription factor binding...

...Once you have a clear understanding of your experimental goal, you are ready to start navigating the different...generate stable cell lines (for details, see Plasmids 101: Mammalian Vectors ) Transient or stable expression... gRNA & Cas9 Validate Results Publications Get Started CRISPR is a powerful system that enables researchers...section will provide a general framework to get you started using CRISPR in your research. Although we will...cell types (e.g. HEK293 cells), transfection with standard transfection reagents may be sufficient to express...details about lentivirus, see our Lentivirus Guide ) Stable, tunable expression of Cas9 and/or gRNA in a wide...compatible with smaller Cas enzymes) Transient or stable expression of SaCas9 and/or gRNA Infects dividing...

...neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene, ...Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG...Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA...

...control molecular signals and cells in order to understand their functions. Example schematic of an optogenetics...the brain and nervous system to better map and understand neuronal circuits. Optogenetic tools have also...disorder research, helping scientists to better understand Parkinson’s disease, depression, drug addiction...photocurrents 470 SFO/SSFO Step function Opsins and Stabilized Step Function Opsins. Mutations at C128 and D156...to “long lasting,” e.g. seconds to minutes with stable step-function opsins (SSFOs). Opsin delivery systems...opsin expression. Generally, the most robust and stable expression is achieved in a transgenic mouse line...

...plasmids optimized for use in AAV, or containing Staphylococcus aureus (SaCas9) . AAV is also a promising method...response, is non-pathogenic even in the wild-type state, and is thus thought to be the most suitable virus...quickly released through cell lysis. Episomal stability enables long-term transgene expression in non-...been well characterized and may be preferred over standard viruses for in vivo applications. Scientists have...divided between two transfer plasmids, but with substantial sequence overlap. Co-expression induces homologous...

...CRISPR libraries include: resistance to the anti-cancer drug vemurafenib , resistance to Clostridium septicum... A well-designed screen can help you begin to understand what genes are important to a certain phenotype...septicum alpha-toxin , and resistance to to the nucleotide analog 6-thioguanine . Next-generation sequencing...

...This method utilizes a packaging cell line that stably expresses Gag-Pol and/or Env, eliminating the need...packaging cell line developed by Garry Nolan at Stanford contains Gag-Pol and either an ecotropic envelope...differentiated (non-dividing) cells. Both lentiviruses and standard γ-retroviruses use the Gag, Pol, and Env genes...provirus. 3' LTR in cis Terminates transcription started by 5' LTR by the addition of a poly A tract just...

...dsDNA at a specified distance away from the recognition sequence. Cutting distal to their recognition ...This may be due to speed, cost, availability of starting materials or just personal preference. Check out... fragments you want to assemble before you get started. Check out Addgene's website for easy to use MoClo...

... adenoviral plasmid. One can also co-transform standard BJ5183 with supercoiled pAdEasy™ and the shuttle...information about AAV, read our AAV guide . Can I make a stable cell line with adenovirus? No, adenoviral vectors...with each round of amplification. What is RCA? RCA stands for r eplication c ompetent a denovirus. This may...

...chemistry behind Gram’s crystal violet stain and the ion interactions that cause the stain retention in gram...positive bacteria trap the crystal violet stain within their membrane, while the stain is washed from the gram...realized that certain stains were retained only in some species of bacteria. The stain colored one type, ...Gram’s discovery, adding a second stain, safranin, as a counterstain to help visualize the bleached bacteria...Procedure The stain is a pretty simple process. First, flood the heat-fixed smear with the crystal violet stain... bacteria will be stained blue or purple, and gram negative bacteria will be stained red or pink, as shown...mixing the stains and solutions used, check out these resources.   Bruckner, M. Gram Staining. https://...

...without a resistance gene, allowing resistant bacteria to multiply, spreading their resistance genes throughout...antibiotic resistance is upon us, and the world is unprepared. Each year in the United States, two million...antibiotic resistant bacteria. Even when researchers develop new antibiotics, the onset of resistance is swift...antibiotic resistant bacteria with a weapon that they’ll have less potential to become resistant to? CRISPR...or antibiotic resistant bacteria, and inappropriate antibiotic usage selects for resistant bacteria, allowing...propagate their resistance genes. Our society is hoping to combat antibiotic resistance using multiple ...development of resistance will be slow. CRISPR may be just the method needed to jumpstart the fight against...

...Direct staining is quicker than indirect staining and eliminates potential non-specific staining that may...its native state.  Antibodies-based flow cytometry can use both direct and indirect staining methods. In...intracellular staining where binding of large immune complexes may be hindered. Indirect staining can be beneficial...fixation. If staining both cell surface and intracellular proteins in parallel, then stain the surface ... non-specific staining.  If you’re using antibodies for detection, include an unstained control with cells...cells that went through the staining procedure minus the antibody. An unstained control allows you to detect...-specific staining associated with the primary antibody. When following an indirect staining protocol,...

... electrons are elevated from a ground state to an excited state through the absorption of photons. After... elevation in this excited state, the electron returns to its ground state by emitting a photon with slightly...lengths of time, the stability of fluorescence over time is crucial. For instance, the fluorescence of...toxicity and high photostability is crucial. These properties ensure a more consistent and stable signal over...Fluorescence refers to the emission of light by a substance (fluorophore) that has absorbed light or electromagnetic...al., 2014). Other dyes may prove challenging to stain intracellular compartments in in vivo model systems...so extra care must be taken to assess if proper staining is achieved. Fluorescent ligands have more flexibility...

...which heavy chain constant domain it pairs with its variable chain domain. B cells start by co-expressing...expressed with the IgM and IgD constant domains because they are the first constant domain genes in the cluster...heavy-chain constant genes μ and ẟ. These are the first two genes in the heavy-chain constant domain gene...heavy-chain constant domain genes, placing the variable domain genes next to a different constant domain gene... antibody that’s determined by its heavy-chain constant region (see Antibodies 101: Introduction to Antibodies...antibody isotypes that each have a unique heavy-chain constant region: IgM, IgD, IgG, IgE, and IgA.    ...labeled with Fc, Fab, heavy chain, light chain, constant region, and variable region.   Why are antibody...

...reporter. The only caveat is that HA staining is weaker than reporter staining. Picking the right reporter for... them. HRP RANbody staining results in a ≥10-fold increase in signal over staining with a primary/ labeled...antigen with a standard primary/labeled secondary Less sensitive than HRP-RANbody staining Requires secondary... IgY antibody Staining cultured cells and tissue sections Great for multicolor staining of tissue since...antigen with standard primary/labeled secondary   Less sensitive than HRP-RANbody staining Requires secondary...secondary antibody staining GFP, RFP, H2A2B   Are you ready to start making your own RANbodies? Great...tissues. Although antibody production is well established, it’s also a process that’s difficult for individual...

...photoswitched from a dark state to a bright fluorescent state (“kindling”), and from a bright state to a dark non-...be activated from low fluorescent states to high fluorescence states, they can change from one fluorescent...switched on from a state of dim or no fluorescence, to a brighter fluorescent state by exposure to a specific...Padron is photoconverted from a dark state, to an activated state, emitting bright green fluorescence.... and ability to switch from a dark state to a red fluorescent state make them useful for 2-color imaging...parameters to consider, such as brightness, photostability, pH stability, chromophore maturation rate at 37 °... monomeric) and display bright and photostable green and red states. Beyond these imaging applications...

...cancer development, metastasis, and drug resistance, Bhang says “the [drug] resistance story panned out ...Using ClonTracer to study drug resistance Although Bhang and co-workers started using the tool to look at ...cells that represent the preexisting resistant subpopulation 2. Resistant cells among the separate replicates...majority of the resistant populations. In fact, 88% of the barcodes within the resistant populations were... populations with resistance to both drugs. The future of ClonTracer Since starting her new role as an...determine whether or not cancer cell populations resistant to drug treatments arise during treatment or are...preexisting in the parent population prior to the start of treatment. They hypothesized that, if they labeled...