...FPs) offer scientists a simple yet powerful way to tag cellular proteins and investigate protein localization...fusion, etc). For example, by engineering PA-GFP tagged to a mitochondrial matrix protein (mito-PAGFP) ...Markus, and Wei‐Lih Lee. "Photoactivatable GFP tagging cassettes for protein‐tracking studies in the budding...an FP-chimeric protein may be at any one of many stages of synthesis and degradation. For this reason it...reversible photoactivation - and have enabled sophisticated imaging techniques.     Irreversible photoactivation...victoria) GFP (wtGFP) by mutating Threonine 203 to Histidine (T203H) (1). wtGFP normally contains a mixed population...PA-FPs by performing several rounds of random mutagenesis screening for enhanced RFP variants. PA-mCherry...

... Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs...Available modifications include: histone acetylation by p300 histone demethylation by LSD1 cytosine methylation...for targeted epigenetic modification, including histone acetylation/demethylation, and cytosine methylation...

...collections: Tags and Other Markers : Antibodies targeting popular markers like tubulin or epitope tags like ...species. We currently assess western blot, immunohistochemistry, and immunocytochemistry. Addgene will continue...

...NanoLuc® with either SNAP‐tag or HaloTag7 tag in which labeling of the self‐labeling tag with a fluorophore ...and Renilla luciferase are less-than-ideal protein tags due to their large size. NanoLuc® Luciferase is ...biosensor that utilizes Renilla luciferase and a Halo tag to assay mRNA decay in real time. pKC-4.04, pKC-4.06...Lentiviral expression of firefly luciferase with a V5 tag Kevin Janes 83281 pAAV-CAG-FLuc Firefly CAG AAV expression...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (neo)...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian...systems. Each type of luciferase has advantages and disadvantages depending on the application. Firefly...

...of CRISPR in 2013 (Cong et al., 2013)! Haoyi got his first exposure to CRISPR when he used this new technology... embryos as Cas9 from S. pyogenes and has the advantage of being smaller (Zhang et al., 2016). For editing...replacement of the murine sequence with a human gene. Advantages of using CRISPR for mouse genome engineering ...the efficiency discussed above extends 4 major advantages of CRISPR mouse editing when compared to more...Post for Tips on CRISPR Gene Editing in Mice Disadvantages of using CRISPR for generating mouse models ...

...Fluorescent Protein Should I Use? However, fusion proteins tag your protein of interest with a fluorescent reporter...protein. One downside of fusion proteins is that the tag can alter the structure of the protein. In some cases...timing of expression can also be affected by the tag.  Protein expression, measured using antibody conjugated..., determining cell health, analyzing cell cycle stages, and detecting specific populations of cells in...system converts the fluorescence intensity to a voltage pulse, called an event, and assigns each event ... then gate the B cell population and create a histogram of CD19-containing cells versus total cell number...

...blogger Jacob Lazarus from Harvard. Jake received his MD and a PhD in Cell and Molecular Biology from the...switched over to pTOX. However, we feel it has clear advantages, and are hopeful that continued development of...

...the sdAb, or by using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs can have ...location. Includes: Immunofluorescence (IF) Immunohistochemistry (IHC) Immunocytochemistry (ICC) Cell Sorting...in these assays. This method is suitable for DNA:histone modifier interactions, which have strong binding...methods such as immunofluorescence (IF), immunohistochemistry (IHC), and immunocytochemistry (ICC) use... they only have one protein of interest. Immunohistochemistry (IHC) and immunocytochemistry (ICC) IF can... can refer to both immunohistochemistry and immunocytochemistry when fluorescent signaling molecules (...

... still infect the researcher and insert into her/his genome - this is a biosafety risk Infects dividing...to infect your cells of interest.   Advantages Disadvantages Can carry large transgenes (>8 kb) Potential... cells, it was obvious that its safety was a disadvantage particularly for clinical development. In addition...Efficient gene transfer Potential for insertional mutagenesis: Replication-incompetent lentiviruses with human...

...GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes...GAAAAGGATAATTGAGCCCCAGG 64254 tag S. pyogenes 26355004 Mendenhall GABPA H. sapiens TTTGGAGTCTCAGAATGTCCTGG 64255 tag S. pyogenes... 24967838 Mashimo ATF1 H. sapiens TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall ATM...pyogenes 25307933 Vale CEBPB H. sapiens CTCCGGCCACTGCTAGCGCGG 64036 tag S. pyogenes 26355004 Mendenhall CEBPB...CEBPB H. sapiens GCCGGCAGGGGGACGCGCGCGG 64047 tag S. pyogenes 26355004 Mendenhall Cent1 M. musculus GGCAACGTTTGACTTCCTGA...Xue RAD21 H. sapiens CCAAGGTTCCATATTATATAAGG 64057 tag S. pyogenes 26355004 Mendenhall rde-1(D718) C. elegans...rerio GTGCGCAACACATAGCACCA 65566 cut S. pyogenes 25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914...

...likely to lead to scores. That player doesn’t trust his teammates; the teammates don’t trust him. This team...Meselson-Stahl, Hershey-Chase...Who was I to dispute history? And boy did I make the right decision. If I’d ...the first place? Let’s think about some of the advantages of team-based work: Nobody knows everything anymore...Jefferson dined alone.” There was a time in human history when an intelligent, motivated person really could...

... lab of Arlene Sharpe at Harvard Medical School. His projects include investigating negative regulators...itself, like laser type and power, acquisition voltage, the concentration of the fluorophore, and whether...bd-spectrum-viewer.   But what is the real-life advantage of a brighter fluorophore? Strong brightness makes...

...DNA. The system can use common tags, like 3xFLAG-tag, PA, and biotin tags, or an anti-Cas9 antibody. The...in mammalian cells include: SunTag system - co-expression of epitope-tagged dCas9 and antibody-activator...acid, turn a promoter on/off, or add small protein tags. Precise Modifications Using Homology Directed Repair...genetic modification ). Browse Plasmids: Endogenous Tagging CRISPR Base Editing To overcome low HDR efficiency...also be fused to the gRNA to recruit fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR ...dCas9s (e.g. S. pyogenes dCas9 and S. aureus dCas9) tagged with different fluorescent proteins or by fusing...sequence specified by a particular gRNA. Epitope tag(s) are fused to dCas9 or gRNA for efficient purification...

... vectors for experiments encoding a fluorescent-tagged molecular tool.   Find pAAV-FLEX-tdTomato, pAAV-GFAP104...variant in AAV1 at Addgene! Archon1, a voltage sensor AAV Historically, electrical activity in the brain was...measured with implanted electrodes. The Archon1 voltage reporter allows a way to monitor neuronal electrical...Archon1-KGC-GFP-ER2]) of this membrane-embedding voltage detector. Find Archon1 and its cre-dependent version...pAAV-hSyn-EGFP *Also coming in our new 20 ul trial size! Voltage indicators Plasmid Serotype Name 119036  AAV1...

...genome-wide screening. Purify dCas9 fused to an epitope tag can be used to isolate a given genomic locus. Visualize...discover links to CRISPR forums, and more. CRISPR History : Learn how CRISPR was modified from a bacterial...

...proteins in E. coli (Zhu et al., 2022). It uses the TAG codon for the phosphoserine and, because it uses ...technology or as a therapeutic.  A (very) brief history GCE came onto the synthetic biology scene in 1989...essentially those needed to make site-directed mutagenesis, many researchers new to GCE aren’t able to successfully... V. W. (2021). Genetic Code Expansion: A Brief History and Perspective. Biochemistry, 60(46), 3455–3469...

...markers, promoters, origins, tags, and certain ORFs. Their sophisticated detection algorithm easily and...

...wrmScarlet11 which is less than 60 nt in length to tag the target protein. The team validated this tool ...2020.07.02.185249 Predicting cell cycle length with a histone-fused fluorescent timer By Kate Harten DeMaio Studies...color-changing fluorescent timer (FT) protein to the histone H2B that allows for  observation in live cells.... human and plant cells. Its small size offers advantages for cellular delivery. Get the plasmids at Addgene...

...localization 1 TagBFP 399nm/ 456nm histone 2B (H2B) Chromatin 2 Cerulean 433nm/ 475nm Lyn-tag (derived from...newly generated MCS. MXS-chaining also has the advantage of being directional, meaning that (in the previous... 3. Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO.Enzymatic assembly of DNA molecules...

...inclusion of non-canonical amino acids or peptide tags. 5) Strong protein-protein interactions with other...typically used in microscopy-based assays like immunohistochemistry, though they are also a common choice for...through several different mechanisms. Most take advantage of chemical groups intrinsically present on antibodies...