...repository. 100,000 Plasmids Shipped! - By 2010, Addgene had hit our stride. We shipped our 100,000th plasmid... 10 years ago today. In that time, Addgene has shipped over 350,000 individual plasmids to 5,000 different...cells into pluripotent stem cells. Plasmids from Shinya Yamanaka's lab and James Thomson's lab were the...

...https://doi.org/10.1126/science.aav7271 Yoshimi, K., & Mashimo, T. (2022b). Genome editing technology ..., Demircioglu, F. E., Moeller, L., Kocalar, S., Oshiro, R., Makarova, K. S., Macrae, R. K., Koonin, E....j.mib.2017.05.008 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. ... S., Wolf, Y. I., Iranzo, J., Shmakov, S. A., Alkhnbashi, O. S., Brouns, S. J. J., Charpentier, E., Cheng...

...absorbed. This phenomenon is known as the Stokes Shift, or the difference in wavelength between peak excitation...background signals when used with the same protein (Hayashi-Takanaka et al., 2014). Other dyes may prove challenging...accurate and reliable imaging and assay results (Hayashi-Takanaka et al., 2014)​​. Conjugates with lower...for intracellular fluorescence live imaging ​​(Hayashi-Takanaka et al., 2014). Dyes can also vary in their...), 987–994. https://doi.org/10.1038/nmeth.4403 Hayashi-Takanaka, Y., Stasevich, T. J., Kurumizaka, H.,...

..., hypercompetition is corroding values, we are shifting away from PI driven basic research, there is resistance...be radically overhauled.  Finally, the science publishing system needs to be changed.  Dr. Bourne charged...applause when he talked about how he boycotts publishing in all but open access journals.  Dr. David Glass...systemic flaws” by Bruce Alberts, Marc W. Kirschner, Shirley Tilghmanc and Harold Varmus     ...

...communication. When I started my Science Communication Internship with Addgene, I didn’t know a lot about scicomm... few Addgene guest blog pieces. Throughout my internship, my interest in scicomm has grown and now it ...is Hans Packer - science writer  When Hans was finishing up his PhD in Molecular Neuroscience at the University...Technologies (IDT). “It was fairly accidental. I was finishing graduate school, and didn’t have anything lined...

... Their cooler boxes come with a prepaid return shipping label. To return the box, simply peel your address...details on what they accept and to print a free shipping label. Recycle nitrile gloves Terracycle is a .... They’re really easy to spot and even easier to ship back. Be that person! If you use serological pipettes...in your tissue culture room for the wrappers and ship them back. Start a glove recycling program at ...

...for Microbiology (ASM) Scientific Writing and Publishing Institute. Writing is the cornerstone of any ...manuscripts and the ASM Scientific Writing and Publishing Institute (SWPI) is an extremely beneficial guide...to sign up for a writing intensive weekend in Washington D.C. at the ASM headquarters. I decided to go...Resources on the Addgene Blog Dos & Don'ts When Publishing a Scientific Manuscript Writing Scientific Manuscripts...

...islands,” said Tetsushi Sakuma, a lecturer at Hiroshima University who works with Takashi Yamamoto. “Addgene...materials at Addgene is that we cover all of the shipping logistics and facilitate all material transfer...

...Waardenburg Syndrome Last but not least, Meng-Shin Shiao (right) of Mahidol University’s Ramathibodi Hospital... Addgene will make a substantial difference in pushing the work forward. Xeroderma Pigmentosum Hendrik...precisely.  To put this award into perspective, Shiao wrote in an email: “In Thailand, our annual operating...

...infrastructure and offered to collaborate with them. The partnership was fruitful and a first version of the study... the power of collaboration and join efforts to shift scientific culture towards a more generous and rewarding...asymmetric collaborations.” These are transient partnerships where a researcher makes a small but crucial...from becoming starting points for long-lasting partnerships Join us! We are a community of researchers who...

...which can help determine structure and function relationships or, in more practical applications, allow a ...some systems, rare codons and four-amino acid frameshift codons are also used. Note that some systems ...idiosyncrasies presents a significant barrier for those wishing to use it as a tool. In short, while the technical... any of a huge variety of ncAAs to study the relationship between structure and function…if you can get...

...researchers - some readily found at Addgene. Shining light on transcriptional activation using dCas9... to control transcription. Two separate labs, Moritoshi Sato’s lab at the University of Tokyo and Charles... site of AcrIIA4, this unfolding conformational shift can interfere with activity. The resulting system...Niopek D (2020) Optogenetics and CRISPR: A New Relationship Built to Last. In: Methods in Molecular Biology...Nihongaki Y, Furuhata Y, Otabe T, Hasegawa S, Yoshimoto K, Sato M (2017) CRISPR–Cas9-based photoactivatable...

...is the question. When presenting on building relationships (also known as “networking”), one of the most...networking to start, build, and track professional relationships. Here are my seven best tips beyond the basics...on LinkedIn!” resulting in just a little more relationship. Pro tip: Once you are connected with someone...connection requests LinkedIn is a place to build relationships. If you don’t add a personal note, you waste...

...-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-...

...teachers; organizing Congressional briefings in Washington DC; convening meetings of experts and leaders...the biological sciences, as well as to acquire leadership and communication experience. These included ... lectures, writing science articles for a lay readership, and working with middle and high school students...obtaining my PhD and working in digital academic publishing for a year, I’ve since returned to pgEd as a ...

... impossible to interpret. Polishing the fiber optics with diamond polishing paper of sequentially increasing...its output with a light meter before and after polishing. Efficiency of the implant should be at least ... output. The same considerations apply to the polishing and preparation of the patch cable (although you...

...a FRET acceptor to mRuby2 or mScarlet. Image: Murakoshi et al., 2019. ShadowR is an orange light-absorbing...light-absorbing chromoprotein that Hideji Murakoshi’s lab developed as an acceptor for fluorescence lifetime...https://doi.org/10.1074/jbc.m606921200 Dove SG, Takabayashi M, Hoegh-Guldberg O (1995) Isolation and Partial...1). https://doi.org/10.1186/s13036-018-0100-0 Murakoshi, H., Horiuchi, H., Kosugi, T., Onda, M., Sato,...

...properties once exclusive to small-molecules: red-shifted spectra, ion sensitivity, photoactivation, etc....sample is wholly dependent on the photon budget and pushing the frontiers of fluorescence microscopy often ...can feel like a college student searching couch cushions for spare change, desperate to extract a few more...which is particularly important for samples where washing is difficult, such as intact tissue. Some chemical...

...two independent groups (Komor et al., 2016 and Nishida et al., 2016) invented CRISPR-base editors by tethering...27096365. PubMed Central PMCID: PMC4873371.  2. Nishida, Keiji, et al. "Targeted nucleotide editing using...25733849. PubMed Central PMCID: PMC4371917. 5. Shimatani, Zenpei, et al. "Targeted base editing in rice...PubMed Central PMCID: PMC5972399. 12. Molla, K., Shih, J. & Yang, Y. Multiplex CRISPR-mediated base editing...

...insertion that disrupts fluorescence due to a frameshift. Restoration of fluorescence can only occur through...Harris Lab relies on the restoration of a frame-shift in mCherry that restores fluorescence to monitor...tyrosine generating a GFP variant (GFPY66) that has a shifted emission spectra. Thus a successful base editing...with a cytidine deaminase base editor results in shift in emission spectra from BFP to GFP. Image from ...