..., 156 (5), 935–949. PMID: 24529477 Nishimasu, H., Shi, X., Ishiguro, S., Gao, L., Hirano, S., Okazaki,...Wang, H., Yang, H., Shi, L., Katz, Y., Theunissen, T. W., Rangarajan, S., Shivalila, C. S., Dadon, D. B...30575746 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert...Reviews Genetics . 16 (5), 299–311. PMID: 25854182 Shi, J., Wang, E., Milazzo, J. P., Wang, Z., Kinney, ... Replogle, J. M., Adriaens, C., Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., Pogson, A. N.,...32203383 Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I., Dohmae, N., Ishitani, R., ... Cell , 46 (5), 595–605. PMID: 22521689 Yoshimi, K., & Mashimo, T. (2022). Genome editing technology and...

...PsChR1 Red-shifted chloride-conducting channel from Proteomonas sulcata 540 Phobos Blue-shifted iC++ variant...467 Aurora Red-shifted anion-selective ReaChR variant 517 Halorhodopsins Jaws Red-shifted, light-driven...kinetics: Examples: ChETA, C1V1(t/t), ChrimsonR Red-shifted peak action spectra Examples: VChR1, C1V1(t/t),...amplitude Examples: eNpHR, eNpHR2.0, eNpHR3.0 Red-shifted peak action spectra Example: Jaws Browse Halorhodopsin...K176R mutation. 590 PsChR2 High-efficiency blue-shifted channelrhodopsin from Platymonas subcordiformis...2014. Noninvasive optical inhibition with a red-shifted microbial rhodopsin. Nat Neurosci. 17(8):1123-9... Yizhar O, Hegemann P, Deisseroth K. 2008. Red-shifted optogenetic excitation: a tool for fast neural ...

... K, Ji B, Takahashi M, Huang X-P, Slocum ST, DiBerto JF, Xiong Y, Urushihata T, Hirabayashi T, Fujimoto..., Jin J (2015). The First Structure–Activity Relationship Studies for Designer Receptors Exclusively Activated...English JG, Liu J, Inoue K, Kumata K, Seki C, Ono M, Shimojo M, Zhang M-R, Tomita Y, Nakahara J, Suhara T, Takada...

... Exons near the N-terminus are targeted since frameshift mutations here increase the likelihood that a...The benefit of this approach is that even non-frameshift alleles may alter protein function when they ...Molecular Biology . 1239 , 197–217. PMID: 25408407 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables...

...price, and other factors like availability and shipping time. Choose antibodies from companies that are...several to compare, or select one based on price, shipping availability, ease of purchase, or similar factors...

...-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-...

..., and thus the plasmid exists in a symbiotic relationship with the host cell. Like the bacterial chromosomal...