...Golden Gate TALEN kit. The GoldyTALEN scaffold is truncated at both the N and C terminus and induces mutation...pC-GoldyTALEN directs expression of TALENs from a truncated CAGs promoter. RCIscript-GoldyTALEN is designed...in vitro mRNA synthesis from the T7 promoter. Truncations were introduced to the N- and C-terminus of the...Golden Gate TALEN 2.0 48705 pTAL7a Boris Greber Application of TALEN technology in hPSCs pTAL7a and pTAL7b...expression in mammalian cells, (iv) an improved, truncated TALE backbone architecture as established by Miller...

... expression, transgenics and genome modification Species-Specific Expression If you want to drive...His or optimized YFP tags for purification or localization experiments Yeast...for bacterial expression (Gateway) GST Protein Purification pEBG - N-terminal GST for mammalian... packaging and expression. See our dedicated lentiviral plasmid page . Retroviral Easy and ...shRNA expression, transgenics and genome modification Element Details Representative Empty ...

...computational pipeline that enables accurate quantification and visualization of CRISPR-Cas9 outcomes, ...off-target sites. This algorithm allows for the quantification of both non-homologous end joining (NHEJ) and...number of potential off-targets, target's genomic location, and genome annotation. Available genomes are ...sequence, which can be an accession number, genomic location, pasted nucleotide sequence, or a sequence text...-EGFP PDF 2.3 MB Zhang GeCKO pooled library amplification 1 vector system: lentiCRISPR v2 2 vector system...

... disruptions, missense mutations located in the MBD, and truncations prior to the NID are more severe ...even within patients with the same mutation, the location and type of MECP2 mutation can be a strong predictor...Line Mutation (DNA) Background Strain Purpose Publication PI Mecp2 NLucTom Knock-in of NLuc-tdTomato at...DNA) Mutation (protein) Sex Source of Material Publication PI N126I A377T N126I M Fibroblasts & iPSC (Link...

...defined by their location, their pathway dependencies are extremely important for classification and treatment...network for transitioning between anabolic and catabolic states. Ras Ras is a GTPase that is essential ... described in the initial Target Accelerator publications, focused on somatic variants found in lung adenocarcinoma...

...Selectable Marker PI Publication Bacterial ID Plasmid Gene/Insert PI Publication Plant ID Plasmid Gene...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Gene/Insert PI Publication Do you have suggestions for other plasmids that should be added to this list?...

... the target site sequence (protospacer+PAM) is located? If there are other PAMs in the region, will they...puromycin selection. You could then confirm this purification by performing a genotyping assay (such as Sanger...genomic DNA as template after performing gDNA purification and have tried conditions with 5% DMSO or without...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Why does...

...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSBs) at a specific location based on a co-expressed gRNA-defined target sequence...genomic changes. Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression...but their function is often limited to a single category (cut, nick, etc.) On the other hand, gRNA plasmids...

...Use this guide to learn about the applications of fluorescent proteins and to find the plasmids that ... Use this guide to learn more about the many applications of fluorescent proteins (FPs) and to find the...scientists. Browse Fluorescent Protein Plasmids by Category Empty Backbones Understand the localization and...Database hosted at the University of Arizona Zeiss Education in Microscopy and Digital Imaging Olympus Fluorescent...

...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ... Plasmid Gene/Insert Vector Type Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression...but their function is often limited to a single category (cut, nick, etc.) On the other hand, gRNA plasmids...

...that opens in response to blue light and allows cations to flow into the cell. Variants of channelrhodopsin...Leptosphaeria rhodopsins, are pumps that can actively move cations or anions into or out of the cell. When using these...Description Gene/Insert Vector Type Promoter PI Publication Return to top Optical Switch Plasmids Browse,...Description Gene/Insert Vector Type Promoter PI Publication Return to top Do you have suggestions for other...

... Tools for Affinity Purification These AAV encode tools for affinity purification (which can be used for...tet-off transactivators and tools for affinity purification (TRAP). Viral... Tools Tetracycline Transactivators Affinity Purification Cell Ablation Tetracycline Transactivators and...

...Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin Adherens junctions 107579 RAB5A-mEGFP AICSDP-39...Proliferating cell nuclear antigen (PCNA) DNA replication foci IPSC cell lines can be ordered from the ...the Allen Institute for Cell Science Cell Catalog. Protocols The Allen Institute for Cell Science has several...PMID: 28814507 Allen Institute for Cell Science Publications...

...copGFP from a truncated EF1 promoter pCDH-EF1S-Nluc 73033 Expresses Nluc from a truncated EF1 promoter ...pCDH-EF1s 72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2-P2A-copGFP 72485 Expresses...pCDH-EF1s-copGFP 73034 Expressed copGFP from a truncated EF1 promoter pCDH-CMV-Nluc-P2A-copGFp-T2A-Puro...

... Protein PI 71367 Human Beta-catenin GFP Adherens Junctions Beta-catenin EGFP Alpha Yap 67937 mouse E-...Michael Davidson 55001 mCherry-Beta-Catenin-20 Adherens Junctions Beta-Catenin mCherry Michael Davidson 30313...chaperones to help with folding or post-translational modification to function properly. Browse or search the table...

...found climbing mountains or playing with his two cats. Keira Havens grew up in Hawaii where she was fascinated...plants engineered to detect explosives and rapidly indicate their presence. They are genetically modified ...enjoy and see a future in. And we decided to make education and outreach a cornerstone of our business, because...

...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled... supplemental materials from the Doyon Lab’s publication: Dalvai et al. Cell Rep. 2015 . Alternatively...programming sgRNA and HR donors for selectable genome modification. This system can be used to create C- and N-...following articles provide PCR templates for amplification of the tag (eg GFP, Flag, YFP, etc) and selection...

... CD147-spike protein . Cathepsin L - Bosch BJ, et al, 2008, J Virol. Cathepsin L Functionally Cleaves ... is involved in virus entry into cells. ( 4 ) Cathepsin L - a cysteine endosomal protease that triggers...Andrew Ellington's lab. High-surety isothermal amplification and detection of SARS-CoV-2, including with ...

...the functional catagories listed below. Narrow down the items available within a category by using the ...experiments can be found on the material pages for viral catalog items. Browse Available Retrograde AAV See our ... Tools Clear Filters ID Name Promoter Activity Category PI Controls 37825 AAV-CAG-GFP CAG GFP Control ...

...Addgene plasmids for use in synthetic biology applications, or from synthetic biology labs.... or sort by the table headings. Click on the publication link to view all plasmids available from the ...Plasmid Description Gene/Insert Vector Type PI Publication...