...non-enveloped viruses, so they are resistant to alcohol-based disinfectants. A 10% bleach solution should ...value greatly. Applying this mantra to AAV selection, there are three important factors related to location...and using AAVs have in common? The three most important items when looking for a house and choosing an...location, location! Just like this common real estate mantra, the choice of serotype (which determines which...the cell type under study. Many AAVs will show significant expression in a variety of cell types, but you...retrograde transport) or towards the synapse (anterograde transport), which is a possible mechanism for...and 9, not only do they undergo retrograde and anterograde transport, but they also have similar transport...

... validated antibody, we recommend using antibody search engines and antibody data repositories to find... that can help: Antibody data repositories, which share validation data, and antibody search engines, ...many different antibody catalogs at the same time.  If you're looking for an antibody, especially a validated...improving antibody quality throughout research, consider checking out the Only Good Antibodies community...If you’re looking for an antibody that works for your experiment, you may be overwhelmed by options —...find an antibody for your experiment. Search engines let you easily find and compare available antibodies...and experimental data to help you decide if the antibody is a good fit for your experiment. They come in...

...looking to use antibody-based applications in their research.  Like all our eBooks, the Antibodies 101 eBook...101 blog posts on an antibody-specific topic, allowing you to easily access relevant information for planning...re very new to antibodies as research tools, you may find “Chapter 1: What is an Antibody” quite useful...to find an antibody that works, we highly recommend “Chapter 3: Finding the Right Antibody for Your Experiment...Experiment.” Whatever your antibody application question, the Antibody 101 eBook is a great place to start...excited to share the very first edition of our Antibodies 101 eBook! The latest addition to our eBook collection...

...Ready-to-use recombinant antibodies at Addgene Addgene's Antibody Guide Addgene's Antibody Plasmid Collection...Addgene blog Antibodies 101: Reading a Flow Plot Antibodies 101: Flow Cytometry Controls Antibodies 101: Validation...single-fluorophore-conjugated antibodies. These methods can include labeling markers with multiple proteins/antibodies, targeting... to antibodies and 'staining' to refer to small molecule dyes. Indirect labeling While antibodies used...fluorophore-conjugated antibody commercially available. In other cases, fluorophore-conjugated antibodies may exist...fluorophore-conjugated secondary antibody is added that binds the conserved, host species-specific (“anti-rabbit”) region...region of the primary antibody (Figure 1b). As above, the advantage of this system is increased flexibility...

... from your antibody panel. They are made up of compensation beads and a conjugated antibody. Compensation...your sample. The isotype antibody will be virtually identical to the antibody for your marker of interest...Introduction to Gating in Flow Cytometry Antibodies 101: Flow Cytometry Antibodies 101: Conventional vs. Spectral...Resources on Addgene.org Addgene's Antibody Guide Browse Addgene's Antibody Collection        ...Depending on the markers you are looking at and the antibodies you are using, you may need to include additional... synthetic beads that can bind to a conjugated antibody and beads that are unable to bind to them: like...The compensation beads can bind to any primary antibody you add. Single color controls are used to help...

... IPI anti-integrin toolset IPI’s anti-integrin toolset comprises 26 recombinant antibodies (rAbs) either...Addgene's Antibody Guide Antibodies 101: Flow Cytometry Antibodies 101: Introduction to Antibodies...Table 1: IPI antibodies  Antibody Target Proteins Reactivity Isotype Source Species Anti-Integrin...unique antibodies that bind discrete subunits or particular subunit pairs. Some of the antibodies in the...property in an antibody is extremely rare. While many function-blocking integrin antibodies exist, almost...are chimeric antibodies composed of rat or mouse variable regions fused with rabbit constant domains. All...monoclonals, we anticipate that our chemically identical hybridoma-derived antibodies will also work in...

...should first note that quantitative PCR (qPCR) has been a powerful tool for quantifying AAV for some time ...producing AAV vector preparations, we have used quantitative PCR to evaluate the physical titer of our preps...digital PCR (ddPCR) comes in. AAV titering using quantitative PCR Before we dive into the details of ddPCR...of a standard - a set of reactions with known quantities of DNA. Additionally, an AAV reference, a virus...by ddPCR begins with diluting the virus. It is important to note that the dynamic range of the ddPCR is...PCR plate. Maintaining a high droplet count is important for calculating the concentration of your sample...separation (Witte et al., 2016). This is particularly important if your amplicon is longer than 150 base pairs...

...editor would restore antibiotic resistance. To find such a protein, they created a mutant library of E. coli...improving base editing platforms for plant systems.  Figure 2: Plant base editor platforms and their...components. Adenine base editors for plant We developed plant adenine base editor (ABE) vectors to install... Cytosine base editors for plant There are several CBEs available for plant systems. Target-AID based ... Figure 3: Activity windows of plant base editors. Plant CBE and ABE with expanded PAM compatibility...constructed a number of plant base editors replacing the SpCas9 with the mutant versions of SpCas9 and ...the base editing scope in rice by using Cas9 variants." Plant biotechnology journal (2018). PubMed PMID:...

...s blog Antibodies 101: Monoclonal Antibodies Antibodies 101: Polyclonal Antibodies Antibodies 101: Introduction...Introduction to Antibodies Resources on Addgene.org Find plasmids encoding recombinant antibodies at Addgene...  Once you get your exciting new antibody, the second thing you’ll want to do is store it away safely. ... check it whenever you use the antibody. This information is important, and you’ll need to track it throughout...accidentally leave your antibody out on the bench overnight. Do not panic! Typically, antibodies are okay if they...light-sensitive conjugate on the antibody left exposed to light?  Has this antibody been left out, gone through...are planning to conjugate your antibody in the lab, you’ll therefore want to research your conjugation ...

...and detection with antisera: a method for studying antibody specificity and antigen structure. Proceedings... repeatedly stripped of an antibody and reprobed with different antibodies allowing multiple targets to...binding to the antibodies during the stain. The ideal blocking buffer depends on the antibodies and labels...your primary antibody Once the membrane has been blocked, it is stained with a primary antibody against your...interest. But which antibody should you use? You will likely find several different antibody options targeting... their antibody binds to protein of the correct size. Many vendors will show that the antibody binds to...that the antibody efficiently binds to endogenously expressed protein at physiologically relevant levels...

...license.    In the third plot, anti-CD14 and anti-HLA-DR antibodies conjugated to fluorescent markers...Cytometry Plasmid-based Recombinant Monoclonal Antibodies Introduction to Antibodies  ... is a cell, but it could be debris or unbound antibodies.) Each event read by the machine is plotted as...conceptualize where the populations are, try drawing a quadrant over the plot that divides it into four, using...different populations by imagining (or drawing) a quadrant over the dot plot. Created with biorender.com....Biorender! While a helpful visualization tool, a quadrant will often be too clean for real-world data. Most...using a panel of markers, which is comprised of antibodies conjugated to fluorescent markers and/or cellular...

...differences include the ferrule implants and patch cables. One huge advantage of using rats is their superiority...but, in today’s post, we’ll discuss some of the important considerations you should think about when developing... preference.   Historically, ICSS was done by implanting an electrode and non-specifically electrically...literature to find all the applications of optogenetics relevant to your field. Ultimately, your question should...stimulation could induce seizures or some other unwanted phenomenon or it could reveal something fascinating...could move your project onto the exciting—and unanticipated—road of discovery. Monitoring behavioral output...interested in studying a brain region that may be important in memory, an appropriate behavioral test might...

.... Other relevant blog posts 3 Challenges in Plant Synthetic Biology Quick, Versatile Plant Transgenesis...As previous blogs have noted, plants are an important foundation for life on Earth. Selective breeding...shaped the plants that we grow and eat, and genetic engineering will continue to improve plant nutrition...inversely proportional to size, and many plant scientists want to transfer large genes, smaller binary ... is functional in a variety of plant species. The kanamycin antibiotic resistance gene is controlled by...PMCID: 4045853.  Find other plant resources at Addgene Check out Addgene’s plant vectors! Find the plasmids...nutrition, yield, and pest resistance. Much of plant genetic engineering revolves around Agrobacterium tumifaciens...

...Viva la (bacterial) resistance!  What are antibiotics? Antibiotics are generally defined as agents that kill...common antibiotics used in labs today are semi-synthetic or fully synthetic compounds. Antibiotics can be...the antibiotics listed in the table below. Note, in this post we'll focus primarily on antibiotics against...how to prepare antibiotic stocks, see Addgene's Reference Page. How else can antibiotics be used in the...scientist to select bacteria that are only resistant to the antibiotic that remains intact. Tips and tricks ...Resistance to antibiotics is a widely used tool in molecular biology, yet scientists rarely stop to think...Additionally, the presence of a plasmid is disadvantageous from the bacterium's perspective – a plasmid-containing...

...other mutants Chronos, Chrimson, ChRmine, ChroME, ChETA, C1V1 (t/t) Inhibitory Arch and variants eNpHR...eNpHR and variants Jaws stGtACR iC++ OPN3 PdCO PPO Bidirectional BiPOLES Promoter CAG CaMKII CBA Dlx EF1a...AAVrg PHPeB Clear Filters ID Name Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2-Venus-AAV... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know...

...gRNA activity. Know your target. Which species or variant of Cas9 ( S. pyogenes, S. aureus etc.) was this...compatible with a single species or PAM binding variant of Cas9 (e.g. Wild-type SpCas9 must be used with...GAGGCATATTCTTCTCCTGG 70660 cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S...elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG...elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661 Fire dpy‐10 C. elegans GCTACCATAGGCACCACGAG...CGAAGTTATATTAAGGGTTC 69992 cut S. pyogenes 25155555 Cepko ANT1 S. lycopersicum ACAATTTAATACACCTTTT 70018 cut S....

...Collections Pooled Libraries Antibodies NeuroMab/Trimmer Lab Recombinant mAb Plasmid Collection CRISPR...Browse depositor collections of antibody, CRISPR, disease research, visualization, protein expression... Simpson Reagents for improved expression of recombinant phosphoproteins - Rinehart FreeGenes Project ...

...depending if you want to use wildtype cas9 or double nickase). For example, if you want to target two genomic... et. al, 2013 Science paper. For example, if you want to use double nickase, you could express two spacers...the two plasmids together into your cells. If you want to use double nickase, you need to have four spacers...Cong et al. , Science 2013 for more details. One important note is that this ‘split RNA’ design is not as...

... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...technologies also indirectly modify local chromatin state. Want more information on the wide variety of Cas enzymes...plasmids for epigenetic modification in mammalian or plant systems. Mammalian ID Plasmid Gene/Insert Promoter...Promoter Selectable Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication...

... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...target the dCas9-repressor to your specific locus. Want more information on the wide variety of Cas enzymes... for expression in mammalian systems, bacteria, plants, and yeast. Mammalian ID Plasmid Gene/Insert Promoter... ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker...