Skip to main content
Addgene

We narrowed to 130 results for: primer

Showing: 81 - 100 of 130 results
  1. AAV Titration by qPCR Using SYBR Green Technology

    Type
    Protocol
    ...Master Mix 2X Primer pair targeting AAV2 ITR ( Aurnhammer et al., 2012 ) fwd ITR primer, 5'-GGAACCCCTAGTGATGGAGTT...10 μL 1,000 μL 100 μM Forward Primer 0.15 μL 15 μL 100 μM Reverse Primer 0.15 μL 15 μL Nuclease Free Water...GGAACCCCTAGTGATGGAGTT rev ITR primer, 5'-CGGCCTCAGTGAGCGA ITR-containing plasmid for standard curve RNase-free... SYBR master mix, then the forward and reverse primers. Vortex briefly, immediately before use. Use a ... of ~70–75 °C usually indicates the presence of primer dimers which can increase background signal and...
  2. Sequencing Primers

    Type
    Guide
    ... Reference Sequencing Primers Sequencing Primers Looking for Primers? The primer sequences listed on the... and see what primers are listed under "5' sequencing primer" and "3' sequencing primer". Still not sure...forward primer Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...not distribute primers. For sequencing plasmids in our repository, we've chosen primers based on the plasmid...sure what primer you need? Email us at [email protected] Addgene has used a number of primers for sanger... Reference Page . All listed primers are 5′ to 3′. Commonly Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG...forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward primer LucNrev ...
  3. Plasmids 101: FLEx Vectors

    Type
    Blog Post
    ...Vectors? Learn about Viral Vector Elements Read Our Primer on Optogenetics    ...
  4. Plan Your Experiment

    Type
    Collection
    ... region of interest can be PCR amplified using primers that (A) flank the region of interest (deletions...
  5. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...expressed is amplified using a gene-specific forward primer containing the desired restriction site (the MCS...has several options) and a pUCX-specific reverse primer containing the missing codons from the antibiotic...if a small contaminating PCR product formed from primer dimers and containing the missing codons from the...resistance gene is inserted. It is important that primers be designed to minimize the possibility of dimer...
Showing: 81 - 100 of 130 results