We narrowed to 1,035 results for: cat
-
TypeBlog Post...diagonal population, this is a sign of spillover and indicates that it is necessary to apply a compensation value...
-
Fluorescent Tagging of Endogenous Genes with SapTrap
TypeBlog Post...Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans.” Genetics. 202(4)... -
Quick Guide to Working with Drosophila Part 1: Getting Started with Flies
TypeBlog Post... from mutations in the gene, and whether any publications have mentioned the gene. The Bloomington Drosophila... -
Plasmids 101: Knockout/Knock-In Plasmids
TypeBlog Post...in line 4 of Figure 4. Since the loxP sites are located in intronic regions, this gene will still be expressed... -
Plasmids 101: Multicistronic Vectors
TypeBlog Post...desktop. The Plasmids 101 eBook is designed to educate all levels of scientists and plasmid lovers and... -
Tips for arabidopsis transformation
TypeBlog Post...Agrobacterium tDNA insertion likely precipitated domestication of sweet potatoes (Kyndt et al., 2015)! It sounds... -
Negotiating Work and Life: How to Find the Joy
TypeBlog Post...other activities. Take care of yourself. Take a vacation alone with your partner – no kids. Get a massage... -
Binning Singletons: Tackling Conference Networking When You Don’t Know Anyone
TypeBlog Post... written up in mSphere. A post-meeting survey indicated that the program was largely a success, but also... -
Designing Your Chalk Talk for the Academic Job Interview
TypeBlog Post...anticipated outcome, and payoff for each aim. Learn to communicate your story with only the most salient details... -
Supporting Reproducibility with a Connected ELN
TypeBlog Post... both accept deposit of data associated with publications into one of five general purpose open source... -
Beyond the Blood Brain Barrier: PHP.B Enters the Central Nervous System Via the LY6A Receptor
TypeBlog Post...Mbp region of the mouse chromosome. Of the genes located in this stretch of DNA, Ly6a seemed the most likely... -
Antibodies 101: The Four ELISAs and When to Use Them
TypeBlog Post...staining. Direct ELISAs also lack the signal amplification afforded by secondary antibodies and thus are... -
3 Tips to Improve HDR Efficiency for CRISPR Editing in Human Cells
TypeBlog Post...many cell types and often results in biallelic modifications. Most commonly, DSBs are repaired by the nonhomologous... -
Deep Mutational Scanning with One Pot Saturation Mutagenesis
TypeBlog Post...created by making some or all of the following modifications: 1) increased concentration of Taq polymerase... -
Generating Mouse Models Using CRISPR/Cas9
TypeBlog Post...interested in using CRISPR to develop therapeutic applications that better human health. References Cong... -
Sequencing Primers
TypeGuide...TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol ... plasmid verification, Addgene has used a number of primers for Sanger sequence verification over the ... AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC Alpha...Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit...pENTR-R ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector/td> Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of...tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato Forward tdTomato-Rev TCTTTGATGACGGCCATGT 5' end of tdTomato... Reverse WPRE-R CATAGCGTAAAAGGAGCAACA 5' end of WPRE Reverse XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin... -
Plasmid Cloning by PCR (with Protocols)
TypeProtocol...Vector by Gel Purification Run your digest DNA on an agarose gel and conduct a gel purification to isolate...not cut within your insert. Are in the desired location in your recipient plasmid (usually in the Multiple...amplify and design primers that will bind to and replicate it. The following image shows the ends of the ...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...need to use the reverse complement to get PCR amplification. We can start similarly, taking the final 18bases... -
Using a Light Microscope Protocol
TypeProtocol...10x magnification. To determine the final magnification of your image, multiply the magnification of your...most important properties of a microscope are magnification (the ability to make an image larger) and resolution...reaches your eyes. These lenses determine the magnification of the image and the resolution your microscope...information, but the most important (for now) is the magnification power, such as 4x, 10x, or 20x. A 4x objective...times, and so on. The ocular lens also provides magnification and the power should be provided on the microscope... your objective lens by the magnification of your ocular lens. For example, if you observe something using...positioning and focus of your image on the lowest magnification, you are ready to move up to the next objective... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol... all publications arising from the use of this vector. A.2 Map of pLKO.1 pLKO.1 is a replication-incompetent...terminal repeat. f1 ori f1 bacterial origin of replication. Amp R Ampicillin resistance gene for selection...bacterial cells pUC ori pUC bacterial origin of replication. 5’LTR 5’ long terminal repeat. RRE Rev response... 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’...AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO... C.1 Recommended Materials Material Vendor and catalog # AgeI New England Biolabs (NEB) #R0552S EcoRI ... D.1 Recommended Materials Material Vendor and catalog # DNA Miniprep Kit Qiagen #27104 EcoRI NEB #R0101S... -
Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps
TypeProtocol...Video! DNA Purification Miniprep, phenol-chloroform extract, and precipitate DNA DNA Quantification Measure...protocols that you can use for a wide range of applications, with videos for select protocols in the right-hand...protocols are the building blocks for many more complicated procedures. Name Description (Link opens in a...bacterial strain Watch the Video! CRISPR Library Amplification Amplify CRISPR pooled-plasmid libraries Diagnostic...Cloning by PCR Generate restriction sites by PCR Modification by Annealed Oligo Cloning Add a short stretch...your gene of to the target of your choice AAV Purification by Iodixanol Gradient Ultracentrifugation Purify...preparation Antibodies Protocols for common antibody applications. Name Description Link to Video Transfection...