...You may also like... Kit-Free DNA Purification Agarose Gel Purification Molecular Biology Reference Introduction...information on nucleic acid quantification, see our protocol for DNA quantification , which can be modified... not affect the quality of RNA or downstream applications. To improve yield of RNA, instead of incubating...

... of sonication to avoid overheating of the sample. Mix well between rounds of sonication. Sonicate until...container pH meter Stir plate Magnetic stir bar Sonicator Ear protection Vortex Reagents Adherent HEK293T...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 1 ... layers are covered with media. 293T cells are delicate and detach very easily - media should always be...completely. Combine all resuspended cell pellets and sonicate 5 x 1 sec pulses with at least 5 minutes on ice...overnight at 4 °C before proceeding with the purification protocol. Sample Data Figure 1: HEK293T cells...

...Electrophoresis DNA Ligation Background Information Gel purification allows you to isolate and purify DNA fragments...restriction enzyme -based cloning. Protocol: Gel Purification Follow the Agarose Gel Electrophoresis Protocol...Protocol with the following amendments: Notes: Gel purification is most efficient with lower % agarose gels,... This is especially important during the DNA purification step, as many kits cannot handle more than a... is most commonly done with a commercial gel purification kit, such as the (Link opens in a new window...purified DNA. Find more information about DNA quantification here . Tips and FAQ How do you get better resolution...

...Immunocytochemistry Protocol Recombinant Antibody Purification Protocol Molecular Biology Reference Introduction...lysis buffer will vary depending on the cellular location of the protein of interest. RIPA buffer is suitable...most proteins but more stringent buffers and a sonication step may be required for hard to extract proteins...BSA standard that range from 0–2000 µg/mL . In duplicate, dilute 10 µL of standard, blank, and lysate samples... nm . Calculate the average absorbance of the duplicate samples on the plate. Subtract the average absorbance...vary depending on the sample type and cellular location of the protein of interest. You may need to try...

...Although your sequencing results may indicate bases at specific locations, by looking at the trace file, you...Diagnostic Restriction Digest Introduction Sequence verification of important plasmid features (such as the gene...file and use the search feature in the program to locate the incorrect sequence. Look at the peaks in the...after base 70 there are multiple peaks in the same location. Looking at the trace file will give you more...

... plasmid together through the transformation/replication process. LIC employs long overhangs to form a...nicked vector product is then repaired during the replication cycle. Empty vectors for LIC typically employ...mixture by gel electrophoresis followed by gel purification . The cut vector end will now look like this...μl Step 4: Amplify Insert by PCR Perform PCR amplification of your insert following the instructions provided...following step. This may be accomplished by gel purification . Step 5: Create Insert Overhangs Treat your...

... Educational Resources Addgene Videos Addgene Videos Browse...lab Over-Agar Antibiotic Plating Protocol AAV Purification Purify adeno-associated virus from a preparation...preparation produced in mammalian cells AAV Purification by Iodixanol Gradient Ultracentrifugation Protocol...separating DNA by size for visualization and purification. Agarose Gel Electrophoresis Protocol Purifying...Purifying DNA from an Agarose Gel Gel purification allows you to isolate and purify DNA fragments based on...

... sample. This protocol was modified from the publication Wang et al. (2018) . Before Starting Thaw the...Scientific, 10199-452 Reagents GeneJet Genomic DNA Purification Kit, Thermo Fisher, K0721 6-well tissue culture...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) Trypsin...FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number Assay: RPP30...the next dilution. Repeat for all dilutions as indicated in the chart below. Dilution Factor Virus Volume...genomic DNA according to the GeneJet Genomic DNA Purification Kit instructions. Determine the concentration...

...The amount of DNA that you cut depends on your application. A diagnostic digest typically involves ∼500 ...volume usually varies from 10-50 µL depending on application and is largely determined by the volume of DNA...manufacturer’s instructions. Pro-Tip Depending on the application and the amount of DNA in the reaction, incubation...you will be using the digested DNA for another application (such as a digestion with another enzyme in a...70 °C for 15 mins, or purifying the DNA via a purification kit, such as a (Link opens in a new window) ...

...General Transfection Protocol Recombinant Antibody Purification Protocol Introduction Transfections allow for...antibody can be purified for use in a variety of applications. Sharing speeds science. We believe that sharing...antibody-expressing plasmids containing the SV40 origin of replication use a HEK293 line stably expressing the SV40 ... containing the Epstein-Barr virus origin of replication use a HEK293 line stable expressing Epstein Barr...the supernatant (see our Recombinant Antibody Purification Protocol ). Store the supernatant at 4 °C until...

...bacteria are used as the means for both storing and replicating plasmids. Because of this, nearly all plasmids...expression) carry both a bacterial origin of replication and an antibiotic resistance gene for use as ...bacteria. Scientists have made many genetic modifications to create bacterial strains that can be more...plasmid DNA for the purposes of storage and amplification. Higher efficiency cells are more important ...

...performed by the T4 DNA ligase enzyme. The DNA ligase catalyzes the formation of covalent phosphodiester linkages...troubleshooting failed ligations. The following table indicates the various controls: Control Ligase Interpretation... treated vector Insert or water + Any colonies indicate contamination of intact plasmid in ligation or... 3:1 ratio is not working or when doing more complicated cloning. While 3:1 will get you in the ballpark...

... Agarose Gel Electrophoresis Agarose Gel DNA Purification Streaking and Isolating Bacteria Inoculating...instructions. If you want to perform plasmid purification without using a kit, you can find a protocol...Na-acetate (pH 4.8) Protocol: Generalized DNA Purification Grow an overnight culture of bacteria . Pro-...using. Store DNA at 4°C. Tips and FAQ Plasmid purification kits provide the fastest way to obtain a high...

...adequately. Divalent cations such as Mg 2+ and Mn 2+ stabilize the buffer solution. These cations can also be ...used for PCR-mediated DNA mutagenesis. A higher cation concentration increases the error rate of the DNA... provide a suitable environment for the DNA amplification reaction. Reference Page Top Index...

... Recombinant Antibodies Recombinant Antibody Purification Protocol Molecular Biology Reference Introduction...mobility of the bands (sample AR0016 in Figure 1) indicates that the samples may not have been processed correctly...ImageJ. Select File . Select Open . Choose the location of the file to open. Change the image type to ...select the Chart Type drop down menu and select Scatter chart. Change the data range and select the cells...

... . The pattern of the fragments on the gel can indicate if the plasmid contains the expected size insert...before use of more expensive forms of plasmid verification, such as DNA sequencing . In the example above...side of the insert, you can get a very obvious verification of the orientation so long as the expected products...

...lentivirus can be used for a variety of downstream applications such as stable-cell line generation. Workflow...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45...inhibit transfection; therefore, plasmid DNA purification should include an endotoxin removal step. For...

...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.1%...Figure 1: A549 cells were transduced with the indicated serial dilutions of the lentiviral vector pRosetta...Figure 2: A549 cells were transduced with the indicated serial dilutions of the lentiviral vector pHAGE...

...dispensed. The boxes that the tips come in often indicate a volume range that the tip can hold. This should...no liquid should drip from the tip. This could indicate that the tip is not on the pipette properly. Place...pipette tip by holding the pipette tip over your dedicated waste container and pressing on the tip ejector...

...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45...lower dilutions depending on your downstream applications. If you’ve titered your virus beforehand, you...that the transgene has integrated in different locations in the various cells in the culture. This is because...