...desktop. The Plasmids 101 eBook is designed to educate all levels of scientists and plasmid lovers and...

...HDR. Optimal mutation in-depth One the most sophisticated features of CrispyCrunch is how it mutates guide...

...diagonal population, this is a sign of spillover and indicates that it is necessary to apply a compensation value...

...other activities. Take care of yourself. Take a vacation alone with your partner – no kids. Get a massage...

...Agrobacterium tDNA insertion likely precipitated domestication of sweet potatoes (Kyndt et al., 2015)! It sounds...

...anticipated outcome, and payoff for each aim. Learn to communicate your story with only the most salient details...

... both accept deposit of data associated with publications into one of five general purpose open source...

...staining. Direct ELISAs also lack the signal amplification afforded by secondary antibodies and thus are...

... written up in mSphere. A post-meeting survey indicated that the program was largely a success, but also...

...Mbp region of the mouse chromosome. Of the genes located in this stretch of DNA, Ly6a seemed the most likely...

...created by making some or all of the following modifications: 1) increased concentration of Taq polymerase...

...many cell types and often results in biallelic modifications. Most commonly, DSBs are repaired by the nonhomologous...

...interested in using CRISPR to develop therapeutic applications that better human health.     References Cong...

... Rabbit beta-globin polyA region, reverse primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol ...tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT 5' end ...primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end of WPRE, reverse primer XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin...sequencing primers that Addgene uses for sequence verification of deposited plasmids. Plasmid...used a number of primers for sanger sequence verification of deposited plasmids. Below is a list of commonly... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward... forward primer Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1...

...Vector by Gel Purification Run your digest DNA on an agarose gel and conduct a gel purification to isolate...not cut within your insert. Are in the desired location in your recipient plasmid (usually in the Multiple...amplify and design primers that will bind to and replicate it. The following image shows the ends of the ...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...need to use the reverse complement to get PCR amplification. We can start similarly, taking the final 18bases...

...10x magnification. To determine the final magnification of your image, multiply the magnification of your...most important properties of a microscope are magnification (the ability to make an image larger) and resolution...reaches your eyes. These lenses determine the magnification of the image and the resolution your microscope...information, but the most important (for now) is the magnification power, such as 4x, 10x, or 20x. A 4x objective...times, and so on. The ocular lens also provides magnification and the power should be provided on the microscope... your objective lens by the magnification of your ocular lens. For example, if you observe something using...positioning and focus of your image on the lowest magnification, you are ready to move up to the next objective...

... all publications arising from the use of this vector. A.2 Map of pLKO.1 pLKO.1 is a replication-incompetent...terminal repeat. f1 ori f1 bacterial origin of replication. Amp R Ampicillin resistance gene for selection...bacterial cells pUC ori pUC bacterial origin of replication. 5’LTR 5’ long terminal repeat. RRE Rev response... 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’...AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO... C.1 Recommended Materials Material Vendor and catalog # AgeI New England Biolabs (NEB) #R0552S EcoRI ... D.1 Recommended Materials Material Vendor and catalog # DNA Miniprep Kit Qiagen #27104 EcoRI NEB #R0101S...

...Video! DNA Purification Miniprep, phenol-chloroform extract, and precipitate DNA DNA Quantification Measure...protocols that you can use for a wide range of applications, with videos for select protocols in the right-hand...protocols are the building blocks for many more complicated procedures. Plasmid Cloning Protocols for constructing...preparations. Antibodies Protocols for common antibody applications. Intro to the Lab Bench Name Description (Link...bacterial strain Watch the Video! CRISPR Library Amplification Amplify CRISPR pooled-plasmid libraries Diagnostic...Cloning by PCR Generate restriction sites by PCR Modification by Annealed Oligo Cloning Add a short stretch...your gene of to the target of your choice AAV Purification by Iodixanol Gradient Ultracentrifugation Purify...

...vector by gel purification Run your digested DNA on an agarose gel and conduct a gel purification to isolate... not cut within your insert Are in the desired location in your recipient plasmid (usually in the Multiple...plasmids. Because you lose some DNA during the gel purification step, it is important to digest plenty of starting...prior to the ligation step or prior to the gel purification step, depending on the phosphatase you choose...isolate the DNA. When running a gel for purification purposes it is important to have nice crisp bands and...bands away from the gel via your favorite gel purification method, it is important to determine the concentration...from your transformation will give you the first indication as to whether your transformation worked. our...

...Load 5 μL of each standard in duplicate Load 5 μL of each sample in duplicate. Do not forget to include a...dilution is appropriate). Quality of duplicates: Exclude duplicates from analyses if there is more than...Considerations Always run standards and samples in duplicate at least If possible, include an AAV reference...standard with DNase ** Make 6 serial dilutions, in duplicate, of your standard curve plasmid (2 x 10 9 stock...second peak at a temperature of ~70–75 °C usually indicates the presence of primer dimers which can increase...point standard curve. Figure 2: Example of the amplification plots obtained from an AAV sample. Each curve...Universal real-time PCR for the detection and quantification of adeno-associated virus serotype 2-derived...