...match your expertise with that of the company. To increase your chances at successfully applying for a position...

...dLwaCas13a as a programmable RNA-binding protein, creating the fluorescent fusion protein dLwaCas13a-NF for...

...using Chr2 stimulation should result in robust increases in c-fos expression in the targeted brain region...

...to the photomultiplier inside the cytometer to increase the electric current and thereby the signal strength...

...collection includes 26 unique antibodies that bind discrete subunits or particular subunit pairs. Some of ...

...ELN team is. Once you’ve made your list of ELNs, create some free or demo accounts and schedule online ...

...based detection of SARS-CoV-2 genetic material (CREST) Sensitivity: 10 copies of RNA per microliter Time...

...technical replicates or repeated measurements will increase the power of the results. In this case, mouse ...

...two-input (ATc and Ara) RSM over a time series of increasing input exposure lengths and found that two hour...

... 2 ligations for each plasmid you are trying to create, with varying ratios of recipient plasmid to insert...

...no wonder that self-labeling protein tags are increasingly popular. Embrace the flexibility and switch ...

...to not have any effect on each other, they have discrete effects on the dependent variable, and those variables...

...beneficial. I’ve made several close friends and found incredible mentors through my own summer experience. Also...

...detected in the same way. The standard curve that is created from the OD and concentration of the known samples...

...combined with site specific recombinase technology like Cre-lox, which allows you to express an opsin ONLY in...using a viral vector with a floxed opsin in a VGAT-cre animal will result in expression of the opsin only...Alternatively, when one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half .... Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression in... include: Increased photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ChIEF Increased channel (... following enhancements: Increased light sensitivity Example: ArchT Increased photocurrent amplitude Examples...Scherffelia dubia ). Synthetic variants have been created via genetic point mutations, codon optimization...

...early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1...

... FLEx vectors block expression in the absence of Cre and are especially useful in AAV experiments where...reporter remains silent until a cell or tissue-specific Cre is provided. Want to know more about FLEx vectors...G-protein and activate neuronal signalling by increasing intracellular cAMP concentrations. There is currently... currently one Gs-DREADD, rM3D, that was created by replacing the corresponding intracellular region of...(R165L) Human M3 muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima...hM3Dq hM1Dq hM5Dq Human M3 muscarinic G αq CNO* Increase Ca 2+ Neuronal burst firing Armbruster et al, ...M3 muscarinic & turkey β1-adrenergic G αs CNO* Increase cAMP Neuronal burst firing Guettier et al, 2009...

...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert... GAT; increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease...others work to increase Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes...backbone HypaCas9 - increase Cas9 proofreading and discrimination evoCas9 - decrease off-target effects...domains to expand PAM recognition, increase specificity, and decrease off-target effects Sniper-Cas9 - ...compatible with truncated gRNAs to increase specificity SuperFi-Cas9 - increases fidelity with reduced nuclease...integration of donor DNA. Genome-Wide Screens Using CRISPR In a genetic screen, a population of cells with mutations...

...Negative Screen Negative screens are a little trickier than positive screens. In a negative screen, the goal...plasmid. Library screens can be divided into two types: positive screens and negative screens. Both types ...reproducibility. Types of Pooled Library Screens In pooled library screens, cells are infected at a very low ... cells. DIVERGE: Positive and negative screens POSITIVE screen: Apply library Apply selection Most cells... of the selection mechanism Positive Screen In a positive screen, the goal is to identify those cells ...been depleted by selection. In a CRISPR screen, negative screens are often used to identify genes that ...Knockout Screening Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens New...

...mutant allele of a gene ( point mutant )? Increase or decrease expression of a target gene? Once you have...High-fidelity Cas enzymes increase specificity. Dual-nickase approach increases specificity but is less ...efficiency. In fact, cleavage efficiency may increase or decrease depending upon the specific nucleotides ...alone for mammalian cell lines. Activate (CRISPRa) Increase expression of an endogenous gene(s) without permanently...vivo A common choice for conducting genome-wide screens using CRISPR AAV transduction CRISPR elements are...Transient expression of CRISPR components Expression decreases as RNA is degraded within the cell Short window...window of CRISPR component expression may decrease off-target effects Can be used to generate transgenic ...