We narrowed to 130 results for: primer
-
TypeBlog Post... the tenth day of CRISPR, Addgene gave to me: a primer on prime editing. On the eleventh day of CRISPR...
-
Mycoplasma Contamination: Where Does It Come From and How to Prevent It
TypeBlog Post...A broad range of primers encompasses almost all the infecting mycoplasma. The primers used in the process...detection is using PCR. In this technique, PCR primers specific to the 16s RNA genes of various commonly... -
The Twelve Days of CRISPR
TypeBlog Post... the first day of CRISPR, Addgene gave to me: a primer on prime editing. On the second day of CRISPR,... -
Antibody Production
TypeCollection...residual plasmid is extracted and amplified with primers targeting the heavy chain and/or light chain variable... -
Pathways Over Time Plasmids Engage Students in Functional Genomics Research
TypeBlog Post..., J.B. Budding yeast for budding geneticists: A primer on the Saccharomyces cerevisiae model system. Genetics... P.A. An ancient yeast for young geneticists: A primer on the Schizosaccharomyces pombe model system. ... -
Plasmids 101: In-house NGS Plasmid Quality Control Now at Addgene
TypeBlog Post...suitable for the library in question. We will order primers that can amplify the insert of the library. This...PCR cleanup kit to remove any template DNA and primers. After performing extensive QC on that sample,... -
Adapting Toehold Switches to Detect Zika Virus
TypeBlog Post...versions of the toehold switches and amplification primers. This helped make sure that we had a number of ...assay’s capabilities. Specifically this includes primer directed isothermal RNA amplification, new toehold... -
CRISPR Plasmids - Prime Edit
TypeCollection...the target site. The longer pegRNA also encodes a primer binding site (PBS) and the desired edits on an ... -
Top Requested Plasmid of 2017 - pMD2.G
TypeBlog Post...lentivirus in another blog post. If you need a quick primer on how lentiviruses work, check out our lentivirus... -
Adenoviral Vector Production and Troubleshooting
TypeBlog Post...determined by a standard curve of known quantity and primers specific for a viral DNA sequence. *Pro-Tip*: Ad5... Addgene Blog Using virus in your research - a primer for beginners Adenoviral delivery of CRISPR/Cas9... -
Anatomy of a Plasmid Page at Addgene
TypeBlog Post... in their own lab. If depositors have provided primer sequences for use, these are listed. We also provide... provide a link to our list of common primers used for sequencing. Growth in Bacteria: This section describes... -
PRIDICT: Predicting Efficiencies of Prime Editing Guide RNAs
TypeBlog Post...sequence, and an extension sequence containing a primer binding site and a reverse transcription template...length of the RTT overhang, the GC content of the primer binding site, and many more. Once we had our datasets... -
AAVs CREATed for Gene Delivery to the CNS and PNS
TypeBlog Post...suitable for PCR amplification using pre-designed primers. By using this library to infect an animal expressing...from the infected animal and use the pre-designed primers to determine which version(s) of the capsid gene... -
CRISPR Plasmids - Bacteria
TypeCollection...by homology to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template... -
CRISPR 101: Homology Directed Repair
TypeBlog Post...for proteins required for strand invasion and a primer for DNA repair synthesis. The ssDNA strand then...invade an intact homologous template to serve as a primer for DNA repair synthesis, ultimately leading to... -
CRISPR Plasmids - Mammalian Expression
TypeCollection...by homology to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template... -
Prime Editing: Adding Precision and Flexibility to CRISPR Editing
TypeBlog Post...activity, enhance binding between the template and primer binding site, increase processivity, or improve...editor; RTT = reverse transcriptase template; PBS = primer binding site. Image from Doman et al., 2023, under...containing the reverse transcriptase template and primer binding site. If this tail is degraded, the truncated... -
CRISPR/Cas9 FAQs Answered!
TypeBlog Post..., but couldn't amplify the EMX1 gene using same primer you used in the Science paper (Cong et al., 2013...publication of our paper, we have two new optimized primers that may work better than the published ones, so...reaction still does NOT work, you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse... -
6 Tips for Analyzing and Troubleshooting Sanger Sequencing Results
TypeBlog Post...unresolved and small, so I suggest designing your primer at least 50bp upstream of the sequence of interest... -
CRISPR Plasmids - Plants
TypeCollection...by homology to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template...