Skip to main content

We narrowed to 133 results for: primer

Showing: 41 - 60 of 133 results
  1. Screening for Successful Genome Editing with Digital PCR

    Type
    Blog Post
    ... that much different from conventional duplexed primer probe assays often used in real time PCR. These...NHEJ. These assays include a forward and reverse primer to amplify the target locus, as well as a reference...
  2. The 12 Days of CRISPR: 2021

    Type
    Blog Post
    ... the tenth day of CRISPR, Addgene gave to me: a primer on prime editing.  On the eleventh day of CRISPR...
  3. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...the target site. The longer pegRNA also encodes a primer binding site (PBS) and the desired edits on an ...
  4. The Twelve Days of CRISPR

    Type
    Blog Post
    ... the first day of CRISPR, Addgene gave to me: a primer on prime editing.  On the second day of CRISPR,...
  5. Adapting Toehold Switches to Detect Zika Virus

    Type
    Blog Post
    ...versions of the toehold switches and amplification primers. This helped make sure that we had a number of ...assay’s capabilities. Specifically this includes primer directed isothermal RNA amplification, new toehold...
  6. Adenoviral Vector Production and Troubleshooting

    Type
    Blog Post
    ...determined by a standard curve of known quantity and primers specific for a viral DNA sequence. *Pro-Tip*: Ad5... Addgene Blog Using virus in your research - a primer for beginners Adenoviral delivery of CRISPR/Cas9...
  7. Anatomy of a Plasmid Page at Addgene

    Type
    Blog Post
    ... in their own lab.  If depositors have provided primer sequences for use, these are listed.  We also provide... provide a link to our list of common primers used for sequencing. Growth in Bacteria: This section describes...
  8. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...by homology to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template...
  9. PRIDICT: Predicting Efficiencies of Prime Editing Guide RNAs

    Type
    Blog Post
    ...sequence, and an extension sequence containing a primer binding site and a reverse transcription template...length of the RTT overhang, the GC content of the primer binding site, and many more. Once we had our datasets...
  10. AAVs CREATed for Gene Delivery to the CNS and PNS

    Type
    Blog Post
    ...suitable for PCR amplification using pre-designed primers. By using this library to infect an animal expressing...from the infected animal and use the pre-designed primers to determine which version(s) of the capsid gene...
  11. CRISPR Plasmids - Plants

    Type
    Collection
    ...by homology to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template...
  12. CRISPR 101: Homology Directed Repair

    Type
    Blog Post
    ...for proteins required for strand invasion and a primer for DNA repair synthesis. The ssDNA strand then...invade an intact homologous template to serve as a primer for DNA repair synthesis, ultimately leading to...
  13. Prime Editing: Adding Precision and Flexibility to CRISPR Editing

    Type
    Blog Post
    ...activity, enhance binding between the template and primer binding site, increase processivity, or improve...editor; RTT = reverse transcriptase template; PBS = primer binding site. Image from Doman et al., 2023, under...containing the reverse transcriptase template and primer binding site. If this tail is degraded, the truncated...
  14. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ..., but couldn't amplify the EMX1 gene using same primer you used in the Science paper (Cong et al., 2013...publication of our paper, we have two new optimized primers that may work better than the published ones, so...reaction still does NOT work, you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse...
Showing: 41 - 60 of 133 results