...indicated serial dilutions of the lentiviral vector pHAGE EF1α dCas9-KRAB . The following day, cells were ...

...2018). xCas9 was generated by the Liu lab through phage-assisted evolution, specifically with the goal of...

...antibodies. The selection process is often performed via phage display, yeast display, ribosome display, or mammalian...

...hypercompact genome editor from the Biggiephage clade of huge phages. In this article, they investigated...as in human and plant cells. Casɸ from Biggiephage can eliminate competing mobile genetic elements...

...method, developed by Invitrogen and based on lambda phage integration sequences, relies on site-specific recombination...

... hospitals. Dr. Qimron proposes using bacterial phage vectors with CRISPR/cas9 sensitizing gene cassettes...

...by using 6-12 phage PP7 coat protein binding sites and 24 copies of the MS2 bacteriophage coat protein ...Synthetic Biology Center have deposited a set of 11 phage integrases which act irreversibly on their cognate.... These pairs are closely related to the lambda phage integrase system which is the basis for Gateway ...authors recently used computational protein design, phage display and high throughput binding assays, to engineer...

...Central PMCID: PMC3760253. 2. Rohwer, Forest. "Global phage diversity." Cell 113.2 (2003): 141. PubMed PMID:...more abundant are the Earth’s estimated 1031 bacteriophages (viruses that infect bacteria), many of which...

...EE-SP!gIII Bacterial SP Cas9 targeting filamentous phage gene III at five protospacers 48671 M-SP-sgRNA Mammalian...

...Antibiotic Resistance Genes Are Used in the Lab Probe Phage Genomes for Host Binding Proteins Learn How to Use...genes from one bacterium to another through bacteriophage (viruses that only infect bacterial cells), ...

... good at flipping. So the lab instead turned to phage serine integrases, where they saw 10-20% integration...

...Edward Fon 116364 pHAGE-ERBB4-K606N ERBB4 EF-1 alpha ALS Kenneth Scott 116365 pHAGE-ERBB4-S774G ERBB4 ...MacGillavry 131791 pHAGE-N-FLAG-HA-TBK1 TBK1 Flag, HA CMV ALS Alicia Pickrell 131792 pHAGE-TBK1-C-FLAG-HA ...ALS Claudia Kutter 175750 pHAGE-eGFP-OPTN OPTN ALS Wade Harper 175760 pHAGE-FLAG-APEX2-OPTN OPTN Flag ...Wade Harper 175762 pHAGE-eGFP-OPTN D474N OPTN GFP CMV ALS Wade Harper 175763 pHAGE-eGFP-OPTN S473A 513A...Wade Harper 175764 pHAGE-eGFP-OPTN S513A OPTN GFP CMV ALS Wade Harper 175765 pHAGE-eGFP-OPTN E50K OPTN...ERBB4 EF-1 alpha ALS Kenneth Scott 116736 pHAGE-ERBB4 ERBB4 EF-1 alpha ALS Kenneth Scott 117701 pmSod1-WT-.../EmGFP-Bsd SOD1 GFP CMV ALS Roger Reeves 177094 pHAGE-APPSw;T719N APP CMV Alzheimer's Wade Harper 177511...

...effector toxins, toxin-antitoxin type toxins, and phage holins. They hypothesized that genes that had evolved...which uses enzymes domesticated from the Lambda bacteriophage, is arguably the most widely and productively...allow replication only in hosts carrying the bacteriophage lambda pir protein. This allows conjugation ...

...hydroxamate uptake, iron uptake receptor mutation. T1/T5 Phage resistance gal Mutation in galactose metabolism...

... homology sequence derived from the filamentous phage F1 (Trapani et al., 2014). Drawbacks: The choice...

...control CRISPR activity. Acr proteins have evolved in phages and other mobile genetic elements to overcome the... edits. These proteins, like Cre recombinase or phage derived serine integrases, insert donor DNA at “... Tolar, J., Osborn, M. J., & Liu, D. R. (2023). Phage-assisted evolution and protein engineering yield...screens in E. coli identify essential genes and phage host factors. PLOS Genetics . 14 (11), e1007749...., Maxwell, K. L., & Davidson, A. R. (2013). Bacteriophage genes that inactivate the CRISPR/Cas bacterial..., J. (2017). Inhibition of CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID...Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors...

...nuclease system involved in defense against invading phages and plasmids. CRISPR loci in microbial hosts contain...

...systems to defend themselves against bacteriophage infection, but some phages fight back using CRISPR inhibitors...3mnx1/Hb9), pan neuronal (elavl3/HuC), microglial/macrophage (mpeg1.1), and astrocytic (gfap).This toolbox...four proteins from Listeria monocytogenes (Lmo) prophage that can inhibit CRISPR function. These Lmo proteins...

...reverse primer pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter, forward primer pLXSN...

...control CRISPR activity. Acr proteins have evolved in phages and other mobile genetic elements to overcome the... edits. These proteins, like Cre recombinase or phage derived serine integrases, insert donor DNA at “... Tolar, J., Osborn, M. J., & Liu, D. R. (2023). Phage-assisted evolution and protein engineering yield...screens in E. coli identify essential genes and phage host factors. PLOS Genetics . 14 (11), e1007749...., Maxwell, K. L., & Davidson, A. R. (2013). Bacteriophage genes that inactivate the CRISPR/Cas bacterial..., J. (2017). Inhibition of CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID...Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors...