...Cell type-biased: Astrocytes - AAV-PHP.AX with GRE or transgenic animal Oligodendrocytes - AAV-PHP.eB with...digital PCR, in vitro and (when possible) in vivo testing, and full sequencing of the final viral vector ...LY6A-nonpermissive mouse strains. **AAV1-X1 has not been tested in rats. Abbreviations: AAV, adeno-associated virus...regulatory element; NHP, non-human primate. Image courtesy of the Gradinaru Lab and the Caltech CLOVER Center...

...bacteria, yeast, Drosophila, zebrafish, C. elegans, parasites, and Xenopus. Addgene CRISPR Resources CRISPR ...genome engineering. CRISPR Topic Page : Want the latest news on CRISPR? Experts cover CRISPR topics on ...promoting DSB formation. Delete NEW Cascade-Cas3 generates large genomic deletions. Insert NEW CRISPR transposases... Activate dCas9 fused to an activator peptide activates gene expression. Interfere dCas9 alone, or fused...

... TALE transcriptional activator target sites and then generates individual user-friendly graphical roadmaps... ( Sander et al., Nat Biotechnol. 2011 ) Rats ( Tesson et al., Nat Biotechnol. 2011 ) Human somatic cells...monomeric TALE transcriptional activator target sites and to simplify the construction of TALEN expression...

...inducible - VIP vasoactive intestinal peptide MGC13587, PHM27 VIPR1 vasoactive intestinal peptide receptor 1 ...immune response is triggered within the first few minutes of exposure to a pathogen and is the dominant defense...Chemokines recruit innate and adaptive immune cells to sites of inflammation throughout the body. Cytokines Cytokines...its cognate antigen along with co-stimulation activates the T cell, whereas T cell tolerance or anergy... NK cells, macrophages, dendritic cells, and granulocytes. TLR The toll like receptors (TLR) play a key...Chemokines recruit innate and adaptive immune cells to sites of inflammation throughout the body. Symbol Name...chemokine (C-C motif) ligand 5 D17S136E, MGC17164, RANTES, SCYA5, SISd, TCP228 CCL7 chemokine (C-C motif)...

...Quality Control Each lot of antibody undergoes testing, either in-house or through outside labs, to confirm...storing at -20 °C. Each antibody catalog item is tested for shipping stability by incubating at 37 °C for..., freezing at -80 °C, thawing on ice, and then testing for loss of potency against a non-treated control...recommended assays. If an antibody has passed stability testing, it may ship at room temperature. However, Addgene...

... easy assembly of one or more gRNA expression cassettes - Qi-Jun Chen. Cas9 and gRNA backbone for use...create plant expression vectors containing several cassettes and generate multi-construct transgenic plants...The ABRC collects, preserves, reproduces, and distributes diverse seed and other stocks of Arabidopsis ... (Link opens in a new window) - The initiative promotes interdisciplinary exchange, open technologies,...

...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...hypermutation in a 100 bp window. This technique creates diverse populations of mutants for directed evolution...adenosine deaminase to catalytically dead Cas13b creates a programmable RNA editor that converts adenosine... transcription factor and other protein binding sites. ID Plasmid Gene/Insert Promoter Selectable Marker...

...The data is also used to determine recombination rates in FLEX/DIO/fDIO constructs. Endotoxin Endotoxin...sterility. Transducibility Some viral vectors are tested in vitro and in vivo for gene expression and/or...line was obtained from Takara, and is routinely tested for mycoplasma contamination using mycoplasma detection... 2 weeks post-thaw, cell culture supernatant is tested for mycoplasma contamination. To date, Addgene ...

...ID Plasmid Description PI Viral Preps Addgene distributes ready-to-use viral preps made from plasmids in...and targeted to the neuronal soma and proximal dendrites in a viral vector Hillel Adesnik 107708-AAV9 pAAV-hSynapsin...ChroME targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a ...and targeted to the neuronal soma and proximal dendrites under the control of internal ribosome entry sequence...recombination Ofer Yizhar Antibodies Addgene distributes ready-to-use recombinant antibodies made from...

...includes titering, purity assessment, sterility testing, and viral genome sequencing (VGS). In-stock AAV...Neuronal Tracing Rabies Virus-Based Serotype Serotype Testing Samples Small samples of control AAV vectors for...CAP-B10, CAP-B22 University of Florida Serotype Testing Panel for the Eye and Brain For enhanced transduction...

... All Antibodies All Antibodies Addgene distributes ready-to-use recombinant antibodies. These monoclonal...recommended applications based on our in-house testing and data provided by trusted outside labs – with... represent the official views of the National Institutes of Health. Need Some Help? Browse some of our...

...induce defined deletions between the two cleavage sites, while the addition of an ssODN donor template can...pU6-BbsI-chiRNA plasmid via the BbsI restriction sites. Design oligos based on the following template: ...known as pHD-DsRed-att). 51026 U6-BbsI-crRNA : Generates crRNA for use in combination with tracrRNA. 51434...

...plasmid, are recombined into a DNA molecule that incorporates sequences from both plasmids. This DNA molecule...for the AdenoBuilder genome assembly system; consolidates the regions present in pAd5-B6 ∆E3-GFP and pAd5... Vogelstein 16407 pAdEasy 2-GFP beta-gal Shuttle Test plasmid that contains β-gal and GFP; contains ∼10Kb...

...Pre-constructed pairs of TALEN plasmids targeting 48 sites in the EGFP reporter gene....large series of engineered TALENs targeted to 48 sites in the EGFP reporter gene ( Reyon & Tsai et al.,...TALENs that were shown to be active at their target sites on an integrated EGFP reporter gene in cultured ...

...such as titering, purity assessment, sterility testing, and viral genome sequencing.... process: Titering Purity assessment Sterility testing Viral genome sequencing (VGS) Find detailed pricing...Addgene does not perform functional or in vivo testing. We recommend that you consult the original paper...

...transfer vectors you can find reporter plasmids to test whether or not you've efficiently generated infectious...recombinases to remove genes flanked by either loxP or frt sites respectively, and empty vectors to express your ...screening and forms blue colonies on LB/Amp/Xgal/IPTG plates — if your insert is successfully cloned into this...

... expressing dCas9-2xAM and gRNA cloned in Bbs I sites. 92221 pLenti_dCas9-2xAM_hIRF-1 Lentiviral plasmid...genome functions.Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 Jun 14;11(1):387. doi: 10.1186/s13104-018-...epitope tags. Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 Feb 27;11(1):154. doi: 10.1186/s13104-018-...

...both the N and C terminus and induces mutation at rates much higher than the parental vectors. pC-GoldyTALEN... Features include (i) Esp3I (BsmBI) restriction sites for full compatibility with the Golden Gate TALEN... 21179091), as well as (v) distinct selection cassettes on pTAL7a and pTAL7b for enrichment of double-...

...DNA is precipitated with alcohol and resuspended in TE buffer. After this, the DNA is ready for use! Plasmid...centrifugation and washed before DNA is eluted with water or TE. The Bishop Lab’s glass milk protocol is adapted ...than 30 minutes and only requires incubating the columns with 1M phosphoric acid for 3 minutes followed...syringe-based method can be completed in 20 to 30 minutes. Additionally, while commercial plasmid prep kits...same as those provided with the kit. Although not tested by the authors, it’s possible that used plasmid... the National Academy of Sciences of the United States of America, 76 2, 615-9 . https://doi.org/10.1073...

... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S. pyogenes...