...contains many unique protospacer sequences that have homology to foreign DNA. Protospacers are separated by...Adaptive Immune System CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) sequences were initially...contain a species-specific sequence known as a protospacer adjacent motif (PAM). The CRISPR complex binds...sequence is only valid if it contains a special Protospacer Adjacent Motif (PAM) directly after where the... development has occurred at a truly astonishing pace, with work directed towards increasing on-target...fidelity Cas9 variants , SpCas9-HF, eSpCas9, and HypaCas9 display very low off-target activity due to rationally...SaCas9) is smaller than SpCas9 and more easily packaged in AAV. Cas9 orthologs also have distinct PAM ...

...consist of a 20-mer (“protospacer sequence”) upstream of an “NGG” sequence (“protospacer adjacent motif” or...Abstract The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated...Figure 2A ). NOTE: In this example, sgRNA-A’s protospacer sequence and PAM happen to fall on the bottom...bottom (Crick) strand while sgRNA-B’s protospacer sequence and PAM fall on the top (Watson) strand ( Figure...will occur independent of orientation of the protospacer sequence/PAM relative to the top or bottom strand...However, if the first position of the 20-mer (protospacer sequence) is G, do not add another G ( e.g., ...cleavage site to ensure detection would not be impacted by a small indel at the sgRNA target site. Design...

... Viral Vector Packaging Service AAV University of Florida Serotype Testing...Testing Panel for the Eye and Brain Viral Vector Packaging Service: University of Florida Serotype Testing... directly to the brain parenchyma or subretinal space Serotypes The following serotypes were developed...acknowledge Shannon Boye and cite Boye, et al. 2016. Impact of Heparan Sulfate Binding on Transduction of Retina...32304666 Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

... (AAV) available from Addgene's viral vectory packaging service. Browse constructs currently available... Viral Vector Packaging Service AAV Browse In-Stock AAV Adeno-associated virus (AAV...can't find the prep you need, try Addgene's AAV Packaged on Request service. You can choose a transfer ...transfer plasmid from our repository and request packaging in one of five serotypes (AAV1, AAV2, AAV5, AAV8, ... For more information, visit our Viral Vector Packaging Service overview. Function Chemogenetics DREADDs...

...Browse Lenti Packaged on Request Can't find what you need in our in-stock preps? Our Packaged on Request...the viral vector prep you need. Packaged on Request Viral Vector Packaging Service Information Production... Viral Vector Packaging Service Addgene produces high-quality viral vector...

...Plasmids Envelope and Packaging Plasmids Popular Lentiviral Envelope and Packaging Plasmids Popular γ-Retrovirus...leukemia virus, and vesicular stomatitis virus G) are packaged as replication-defective virus particles with ...SARS-CoV-2 and other coronaviruses using appropriate packaging plasmids. Use the search bar to find a particular...-Retrovirus Envelope and Packaging Plasmids Reporter Plasmids A few examples of reporter plasmids that...

...protein Selectable markers Viral expression and packaging Reporters, shRNA expression, transgenics and ... lab collection for more) pLexA and pACT2.2 - Yeast 2-hybrid plasmids Fly UAS... expression under the metallothionein promoter pACU2 - Modified pUAST vector containing...InvivoGen trademark. Back to Top Viral Expression and Packaging Although transient expression is sufficient for...extensive collection of plasmids for packaging and expression. See our dedicated lentiviral plasmid...

... Viral Vector Packaging Service AAV Optogenetics Viral Vector Packaging Service: Optogenetics ...Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2-Venus-AAV CAG ChR2 Venus Constitutive 1, 9... Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

...GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48651 cut N....N. meningitidis 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N. meningitidis...meningitidis 24076762 Church Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus 24076762 Church...Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48654 cut S. thermophilus 24076762 Church Protospacer...TACCATCTCAAGCTTGTTGA 48655 cut T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T....

... Viral Vector Packaging Service AAV Caltech Systemic Capsids Viral Vector Packaging Service: Caltech...CAP-B22 AAV9-X1.1 As part of our Viral Vector Packaging Service , Addgene is distributing ready-to-use...window) Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

...for expression of a ZFN targeted to a site with a spacer of 7 bps and harboring a “+” heterodimeric FokI...for expression of a ZFN targeted to a site with a spacer of 7 bps and harboring a “-” heterodimeric FokI...expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “+” KKR heterodimeric FokI domain. ( Doyon ...expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “-” ELD heterodimeric FokI domain. ( Doyon ...

... Viral Vector Packaging Service AAV Molecular Tools Viral Vector Packaging Service: Molecular Tools..., Wells Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

... Viral Vector Packaging Service AAV Serotype Testing AAV Viral Vector Packaging Service: Serotype ...order it? Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

... Viral Vector Packaging Service AAV Recombinases Viral Vector Packaging Service: Recombinases ... Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

... Viral Vector Packaging Service AAV Monosynaptic Neuronal Tracing Viral Vector Packaging Service: Tools...17329205 Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

... Viral Vector Packaging Service AAV Chemogenetics Viral Vector Packaging Service: Chemogenetics...Chemogenetics AAV Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

...details about our viral vector packaging service, visit our Viral Vector Packaging Service page . Pooled CRISPR...lentivirus available from Addgene's viral vector packaging service. Browse constructs currently available... Viral Vector Packaging Service Lentivirus Browse In-Stock Lentivirus Pooled CRISPR...

...host genome. AAVs are limited by their small packaging capacity. Adenovirus Plasmids | Guide Adenoviruses...type, linked above. Virus Expression Genome Packaging Capacity Virus Size (nm) Cells Infected Target Cell...

... Viral Vector Packaging Service AAV Controls Viral Vector Packaging Service: Control AAV Browse... Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

... Viral Vector Packaging Service Penn Vector Core Transfer Viral Vector Packaging Service: Penn Vector...Optogenetics Scott Sternson AV-1-20071P 20071-AAV1 pACAGW-ChR2-Venus-AAV Optogenetics Karel Svoboda AV-1-...pAAV-hsyn-Jaws-KGC-GFP-ER2 Optogenetics Ed Boyden AV-9-20071P 20071-AAV9 pACAGW-ChR2-Venus-AAV Optogenetics Karel Svoboda AV-9-...-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2-Venus-AAV Karel Svoboda AV-5-20949P 20949-...