... fluorescent protein downstream, separated by an IRES element. You did a lot of work! But let’s take a...-thi-1 or thi1 Mutation in thiamine metabolism Requires exogenous thiamine for growth ara disruption...leuB β-isopropyl malate dehydrogenase inactivated Requires exogenous leucine source for growth proAB mutation...mutation in proline biosynthesis pathway Requires exogenous proline source for growth rpsL Mutation ...

.../hum.2019.277 Lavin TK, Jin L, Lea NE, Wickersham IR (2020) Monosynaptic Tracing Success Depends Critically...Conclusion Using AAV vectors in your experiments requires a full understanding of vector performance in ...

...while wavelengths over 700 nm make up the infrared (IR) spectrum. When photons are absorbed by matter, they...

...Mammalian U6 yes, cut S. pyogenes Kuehn pMCS-rybozyme-IRES-CAS9 64668 Mammalian yes, cut S. pyogenes W Fujii...Protocols gRNA Design Tools CRISPR Blog Posts CRISPR requires that you have to express both a Cas protein and...expression of multipe gRNAs. Csy4 cleavable cassettes; requires expression of Csy4 (eg Plasmid 53369 ). Joung ...

...promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES, forward primer IRES-R CCTCACATTGCCAAAAGACG...CCTCACATTGCCAAAAGACG 5' end of IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector...

...different purposes. The pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP ... pAdTrack Class of transfer vectors that contain IRES-GFP pShuttle Class of transfer vectors that do not...DNA viruses. They are not related; however, AAV requires the presence of adenoviral genes E1, E4, E2a and...

...times when you may be working with a protocol that requires shaking or mixing, which may produce aerosols ... PPE protocols . Working in a BSL-2 laboratory requires laboratory glasses in addition to coat and gloves...

...to the template DNA and the Taq polymerase, PCR requires free nucleotides [dNTPs; adenine (A), cytosine... thymine (T)] in an equal molar ratio. It also requires two unique single stranded DNA oligonucleotide...

... ∼500 ng of DNA, while molecular cloning often requires 1 µg of DNA. The total reaction volume usually...

...cell lines and selection markers. Note this assay requires staining resistant colonies with crystal violet...

...enough master mix for all samples). Each sample requires 15 μL of master mix. Pro-Tips Use a "Universal...

...living cells. Visualizing a specific genomic locus requires recruitment of many copies of labeled proteins...gRNAs that tile the locus. Chromosome painting requires delivery of hundreds of gRNAs with target sites...

...expression of a recombinant protein with a 6x His tag. Requires a strain with T7 RNA polymerase. Amp resistant...expression from that element. When this activation requires a transcription factor to bind to a small molecule...

...Chromatin H2B mRFP Bryan Welm, Zena Werb 21045 pH2B_mCherry_IRES_puro2 Chromatin H2B mCherry Daniel Gerlich 25999... alpha-tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha Tubulin Microtubules alpha-tubulin ...

...cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires single-antibody...

...indel formation compared to HDR. Prime editing requires more optimization and typically has lower efficiency...living cells. Visualizing a specific genomic locus requires recruitment of many copies of labeled proteins...gRNAs that tile the locus. Chromosome painting requires delivery of hundreds of gRNAs with target sites...

...28774929 Guettier JM, Gautam D, Scarselli M, de Azua IR, Li JH, et al (2009). A chemical-genetic approach...

...Otx2 expression in the developing mouse retina requires a unique enhancer and either Ascl1 or Neurog2 ...

...17. PubMed . Description Use of the OPEN method requires OPEN pools (available by request from the Joung...

...homologous directed repair (HDR) frequency. CRISPResso requires two inputs: paired-end reads (two files) or single-end...