Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 21 - 32 of 32 results
  1. Chemogenetics Plasmids

    Type
    Collection
    ...Gi) hDlx tdTomato No Fishell 83897 pAAV-hDlx-GqDREADD-dTomato-Fishell-4 hM3D (Gq) hDlx tdTomato No Fishell...GFAP Other Reporter/Fusion mCherry IRES-mCitrine tdTomato ChR2 IRES-EGFP Recombinase Cre-dependent Flp-dependent...pAAV-S5E2-Gq-P2A-dTomato hM3D (Gq) E2 Enhancer tdTomato No Dimidschstein 111397 pAAV-hSyn-DIO {hCAR}off...
  2. Church Lab CRISPR Plasmids

    Type
    Collection
    ...GTCCCCTCCACCCCACAGTG 48677 M-tdTom-SP Mammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG...GTCCCCTCCACCCCACAGTG protospacer 48678 M-tdTom-ST1 Mammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG...GTCCCCTCCACCCCACAGTG protospacer 48679 M-tdTom-NM Mammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG...
  3. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ... pFA6a-link-tdTomato-SpHis5 - Yeast Expression tdTomato-N1 - Mammalian Expression tdTomato-C1 - Mammalian... Bacterial Expression tdTomato 554 581 95 4.7 1 hr Tandem-dimer pCSCMV:tdTomato - Mammalian Expression...Mammalian Expression tdTomato-pBAD - Bacterial Expression Jump to Top Red Protein Excitation (nm) Emission...
  4. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Dorus Gadella 37351 pQC membrane TdTomato IX Membrane Palmitoylation TdTomato Connie Cepko 22479 FUmGW Membrane...118737 pBOB-CARMIL2 BH domain-tdTomato Plasma Membrane CARMIL2 BH domain tdTomato John Cooper *Fusions to other...
  5. Rett Syndrome

    Type
    Collection
    ...NLucTom Knock-in of NLuc-tdTomato at endogenous MECP2 locus Castaneus MECP2-NLuc-tdTomato mouse reporter cell...
  6. Validated gRNA Sequences

    Type
    Collection
    ...ATCACAGTGATGCTCGTCAA cut S. pyogenes 26479191 Kim tdtomato Synthetic CGAAATGAGAAAGGGAGCTACAAC 47869 cut N...
  7. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... 58112 tdTomato-MAPTau-C-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58113 tdTomato-MAPTau-...TARDBP GFP CMV ALS Zuoshang Xu 28205 wtTDP43tdTOMATOHA TARDBP HA, tdTomato CAG ALS Zuoshang Xu 28206 TDP43 ...tdTomato-MAPTau-N-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58259 pBabe-Neuroserpin SERPINI1 Dementia Joan...
Showing: 21 - 32 of 32 results