Skip to main content
Addgene
Showing: 21 - 40 of 131 results
  1. FastCloning: A Newer, Simpler Cloning Technique

    Type
    Blog Post
    ...and the reverse primer is located in the 5’ end of the multi-cloning site. The primers used to amplify...and vector are first PCR amplified. The forward primer used to amplify the vector is located in the 3’...should perform colony PCR with vector specific primers to confirm that the products are the correct size...
  2. Recombinase-based State Machines Enable Order-dependent Logic in vivo

    Type
    Blog Post
    ...amplified by a particular primer pair. Then, by leveraging qPCR data from multiple primer pairs, one can infer...build new registers. The primer binding sites can also be used to design primers to read states by qPCR ... each state of a register enables the design of primer pairs that PCR amplify in some states but not others... regular PCR may not be very informative – each primer pair will amplify even if its target states are... promoters, and genes) were built with flanking primer binding sites (designed to have 20-30 nt length...
  3. Pushing the Limits of DNA Assembly

    Type
    Blog Post
    ...homology can be introduced to fragments via PCR using primers that contain the regions of homology. A powerful...interface can guide you through both experimental and primer design based on fragment sequences and the polymerase... enzymes are adjusted. Appropriate fragment and primer design results in covalently joined, scarless DNA...search Addgene plasmids by gene here), designing primers with your desired mutation, performing PCR to generate...
  4. Design Tips for Prime Editing

    Type
    Blog Post
    ...of the primer binding site, starting with a length of about 13 nt (Anzalone et al., 2019). Primer binding...consists of a CRISPR gRNA extended to include a primer binding site (PBS) complementary to the genome ... 2: Starting lengths for optimizing your pegRNA primer binding site (PBS) and reverse transcriptase template...minimize unwanted intra-RNA base pairing with the primer binding site (Nelson et al., 2022). PE7: This editor...
  5. AAV Titers: Where Do They Come From And What Do They Mean?

    Type
    Blog Post
    ...for binding sites between the primers and the AAV genome repeats. Primer annealing can be affected by... 61° C improved assay reliability. Different primers can have different annealing efficiencies (Wang... et al., 2013). Although you can optimize your primers for each individual sample, this will reduce convenience...each sample with be quantified with a different primer pair. Ct values vary based on the amount of starting...
  6. Tips for CRISPR Gene Editing in Mice

    Type
    Blog Post
    ...Remember the primers you designed to generate your pCAG-EGXXFP plasmid? They are the perfect primer sets to...and has the bonus benefit of supplying you with primers for validating your edit in mice once they have...vitro screening process, you should first develop primers to the approximately 500 base pair sequence surrounding...to genotype your pups. A simple PCR with these primers will let you know if there are any major deletions...
  7. SARS-CoV-2/COVID-19 Detection Methods Based on CRISPR/Cas

    Type
    Blog Post
    ...extracted and subject to isothermal amplification by primers that target the E and the N2 gene of SARS-CoV-2...reverse-transcribed target sequence that are present close to the primer recognition sites and are added separately. Using...fluorescence upon cleavage. Upon amplification by the RPA primers, the Cas12a-crRNA binds to the complementary region...sequence is amplified by PCR/RPA using biotinylated primers. These are then immobilized with streptavidin coated...non-PAM regions, PAM can be engineered into the primers. This method does not depend on collateral cleavage...
  8. Tips for a 1st Time CRISPR User (by a 1st Time CRISPR User)

    Type
    Blog Post
    ...genome browser and Primer3 to design primers that amplified a 500-600 bp product. The primers I designed (listed...Dilution Lentivirus Production Websites Primer3: for Designing Primers UCSC Genome Browser: For eploring genomic...most difficult part of the assay was designing primers flanking my edits in genomic DNA and doing PCR ...samples (data not shown). Pro-Tips: 1.Designing primers against genomic DNA to amplify the gRNA targets...bands using the conditions above. 2. Design your primers so that the digestion site isn’t in the middle ...
  9. Viral Production

    Type
    Collection
    ...are titered by droplet digital PCR (ddPCR) using primers and probes targeting the ITR elements and an internal...incubated for 72 h, and genomic DNA is extracted. Primers and probes targeting integrated copies of the lentiviral...
  10. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ..., but couldn't amplify the EMX1 gene using same primer you used in the Science paper ( Cong et al. , Science...publication of our paper, we have two new optimized primers that may work better than the published ones, so...reaction still does NOT work, you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse...
  11. PCR Applications for Copy Number Variation Assays

    Type
    Blog Post
    ...applications, results can be affected by DNA quality and primer design, particularly for amplicons under 100 bp...technique, courtesy of CAR15.) Each droplet contains a primer and probe set for both the gene of interest and... Chain Reaction (PCR) Protocol: How to Design a primer  Molecular Biology Reference Molecular Cloning ...
  12. Viral Production at Addgene

    Type
    Blog Post
    ...are titered by droplet digital PCR (ddPCR) using primers and probes targeting the ITR elements and an internal...incubated for 72 hours, and genomic DNA is extracted. Primers and probes targeting integrated copies of the lentiviral...the final viral preparation undergoes PCR with primers targeting the transfer plasmid used in the transfection...
  13. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...protothropic cassette can be amplified with the following primers: FW 5'–GGTGACGGTGCTGGTTTA–3' RV 5'–TCGATGAATTCGAGCTCG...
  14. Plasmids 101: What is a plasmid?

    Type
    Blog Post
    ...selectable markers for use in other cell types. Primer Binding Site A short single-stranded DNA sequence...initiation point for PCR amplification or sequencing. Primers can be exploited for sequence verification of plasmids...
  15. Twenty Years of Sharing: Expanding Accessibility

    Type
    Blog Post
    ...Electrophoresis Bacterial Transformation How to Design a Primer Creating Bacterial Glycerol Stocks Inoculating ... Videos What is a Plasmid? How to Design Primers for PCR Agarose Gel Electrophoresis Inoculating...Analysis We also introduced guides — practical primers to help users get started with tools like CRISPR...
  16. Plasmids 101: TOPO Cloning

    Type
    Blog Post
    ...cloning: 1. Create Your PCR Product: Design standard primers (no need to add unique restriction sites on the...Pro tips Do not add 5’ phosphates to your PCR primers; you need that free hydroxyl group! You may want...
  17. Multiple Plasmids at a Low Price: Kits from Addgene

    Type
    Blog Post
    ...unique barcoded Illumina-M13F bridging primer. These bridging primers are amplified and used to generate ... Type IIS restriction enzymes and standardized primers to clone your gene of interest into both sequencing...
  18. 5 Great Apps for Lab Life

    Type
    Blog Post
    ... great if you’re adding a restriction site to a primer, you only need to skim the alphabet on the side...helps you set up an optimal PCR depending on the primer sequence and the NEB polymerase used. Overall, ...
  19. Screening for Successful Genome Editing with Digital PCR

    Type
    Blog Post
    ... that much different from conventional duplexed primer probe assays often used in real time PCR. These...NHEJ. These assays include a forward and reverse primer to amplify the target locus, as well as a reference...
Showing: 21 - 40 of 131 results