We narrowed to 30 results for: actin

...plasmids, or promoters such as the chicken beta-actin promoter of the pHLsec vector. In this scenario,...

...mechanical forces in the cell’s microenvironment. The actin cytoskeleton exerts tensile force, transmitted through...

...polarization independent of GDI-mediated extraction and actin-based trafficking." PLoS biology 13.4 (2015): e1002097...

...Constitutive Insect Strong promoter from Drosophila actin 5c gene Gal4/UAS Specific Insect Requires UAS regulatory...CMV early enhancer element and the chicken beta-actin promoter CMV Constitutive Mammalian Strong promoter...

...different cells. Promoters such as chicken-beta-actin or CAG can drive strong early gene expression, but...

...have been transfected with a plasmid encoding GFP. Actin, a common internal control for Western blots, shows...

...expressed “housekeeping” proteins — like GAPDH or actin — are often used, it is far more accurate to use...

...promoter Forward AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC...

...as mitochondria, as well as macromolecules like actin and myosin, and enzymes for transmitter synthesis...

...from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web page offers...