Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 123 results for: actin

Showing: 21 - 40 of 123 results

  5. Sequencing Primers

    Type
    Guide
    ...AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer Alpha-factor TACTATTGCCAGCATTGCTGC...

  6. Technical Design of a Western Blot

    Type
    Blog Post
    ...expressed “housekeeping” proteins — like GAPDH or actin — are often used, it is far more accurate to use...

  7. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ...as mitochondria, as well as macromolecules like actin and myosin, and enzymes for transmitter synthesis...

  8. Cre-lox system

    Type
    Collection
    ...Cre CMV Xenopus Ryffel 31309 pCARCre Cre cardiac actin Xenopus Ryffel 32144 pJFRC170-3XUAS-IVS-Cre::PEST...

  9. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web page offers...

  10. Split-BioID: An Improved Method for Studying Protein-Protein Interactions

    Type
    Blog Post
    ... as well as the identification of additional interacting factors. Problems with Existing Methods for ... the identification of weak and/or transient interacting proteins. No spatiotemporal control. Many PPI...particular point in time, i.e. when the bait is interacting with a particular protein partner or when the...is its spatiotemporal controlled labeling of interacting proteins; nearby proteins are biotinylated when...labeling ceases when these two bait proteins stop interacting. This feature is particularly useful for in-depth...tetracycline induced expression and biotinylation of interacting proteins. This extended incubation period could...ligase fusion protein identifies proximal and interacting proteins in mammalian cells. The Journal of cell...

  11. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...hsp70: mKate2 dynactin1-811 DCTN1 mKate2 hsp70 ALS Caren Norden 105971 pME mKate2-dynactin1-811 DCTN1 mKate2...115182 pLD-puro-Cc-PARK7WT-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115183 pLD-puro-Cc-PARK7V51G-VA...pLD-puro-Cc-PARK7V51G-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115184 pLD-puro-Cc-PARK7C53A-VA...-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115185 pLD-puro-Cc-PARK7H126A-VA PARK7 His...His, Flag, Streptactin CMV Parkinson's Mohan Babu 115186 pLD-puro-Cc-PARK7E163K-VA PARK7 His, Flag, Streptactin...115187 pLD-puro-Cc-CR-PARK7WT-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115188 pLD-puro-Cc-CR-PARK7V51G-VA...pLD-puro-Cc-CR-PARK7V51G-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115189 pLD-puro-Cc-CR-PARK7C53A-VA...

  12. Proximity Labeling: A Powerful Tool for Protein Complex Purification and Proteomic Mapping

    Type
    Blog Post
    ...protein-protein interaction as well as identify additional interacting proteins in one simple experiment. PCA is an ...reassemble to restore activity when fused to two interacting proteins (Schopp et al., 2016). Thus in one experiment...surface of a cell of interest, where it can label interacting cell surface proteins with a biotin tagged LPETG...ligase fusion protein identifies proximal and interacting proteins in mammalian cells." J Cell Biol 196.6...

  13. Viral Vectors 101: Biosensors

    Type
    Blog Post
    ... pair on actinin will produce different signals based on changes to the structure of actinin in low vs...associated with specific proteins of interest such as actinin. When tension is high vs. low in the cell the donor...

  14. Immunology Research Plasmids and Resources

    Type
    Collection
    ...polypeptide PNP PRL prolactin - PRLH prolactin releasing hormone PRH, PRRP PRLHR prolactin releasing hormone..., CXC3, CXC3C, NTN, NTT, SCYD1, fractalkine, neurotactin CX3CR1 chemokine (C-X3-C motif) receptor 1 CCRL1... GPR10, GR3, MGC126539, MGC126541, PrRPR PRLR prolactin receptor hPRLrI PROK1 prokineticin 1 EGVEGF, PK1...oncogene homolog A-RAF, ARAF1, PKS2, RAFA1 BID BH3 interacting domain death agonist FP497, MGC15319, MGC42355...

  15. Tips for Technical Support Calls

    Type
    Blog Post
    ...biology-related customer support interaction. Before contacting customer service In an age of Tweeting and texting...customer service experience: Make sure you’re contacting the correct company. This might seem like a no-brainer...responses. No one is likely to look forward to contacting customer service, but the experience should never...

  16. Minigenomes - a Safe Way to Study Dangerous Viruses Like the Ebola Virus

    Type
    Blog Post
    ...sequences at its 3’ and 5’ ends that are crucial cis-acting signals for genome replication and viral gene transcription...sequences. Thus, the minigenome contains all cis-acting signals necessary to direct minigenome replication...) can be studied by changing the minigenome cis-acting sequences and monitoring effects on genome replication...

  17. Selecting Your Plasmid Purification Kit

    Type
    Blog Post
    ...normal kit protocols.  Yeast plasmids – If you’re extracting plasmids from yeast, instead of bacteria, a few...kits — there are many more kits out there for extracting DNA from tissues, blood, virus, or other samples...samples, for PCR and gel cleanup, and for extracting RNA! (That’s a blog for another time, however!) Where...

  19. Addgene's Top Blog Posts from 2020

    Type
    Blog Post
    ...it, wrote these tips for working with RNA and extracting RNA without a kit. 3. SARS-CoV-2/COVID-19 Detection...Kit blog post, we've compiled five methods for extracting DNA without a kit too. 1. Early Career Researcher...

  20. London Calling - Addgene’s New Europe Office in London

    Type
    Blog Post
    ...outreach and community engagement. Information about contacting Addgene can be found on our Contact page. You...sharing those ideas with others. This love of interacting with people and talking about science makes her...
Showing: 21 - 40 of 123 results