Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 21 - 40 of 55 results
  1. An Introduction to Adenovirus

    Type
    Blog Post
    ...:/doi.org/10.1016/S1525-0016(03)00023-6. PMID: 12727116. Borkenhagen, L. K., Fieldhouse, J. K., Seto, ...
  2. CRISPR-mediated Plant Base Editors

    Type
    Blog Post
    ...APOBEC3A." Nature biotechnology (2018). PubMed PMID: 30272679. 8. Hua, Kai, Xiaoping Tao, and Jian‐Kang Zhu....
  3. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...Tobias Rose AV-1-PV2723 98929-AAV1 pAAV.hSyn.iGluSnFr.WPRE.SV40 Loren Looger AV-1-PV2724 98931-AAV1 pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40...Baljit Khakh AV-5-PV2723 98929-AAV5 pAAV.hSyn.iGluSnFr.WPRE.SV40 Loren Looger AV-5-PV2724 98931-AAV5 pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40...Schreiter AV-9-PV2723 98929-AAV9 pAAV.hSyn.iGluSnFr.WPRE.SV40 Loren Looger AV-9-PV2724 98931-AAV9 pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40....hSyn.Flex.iGluSnFr.WPRE.SV40 Loren Looger AV-1-PV2725 98932-AAV1 pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 Loren....hSyn.Flex.iGluSnFr.WPRE.SV40 Loren Looger AV-5-PV2725 98932-AAV5 pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 Loren....hSyn.Flex.iGluSnFr.WPRE.SV40 Loren Looger AV-9-PV2725 98932-AAV9 pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 Loren...pAAV-hSyn-eNpHR 3.0-EYFP Karl Deisseroth AV-8-PV3706 62726-AAV8 pAAV-Syn-Chronos-tdTomato Ed Boyden AV-1-35507...
  4. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...28189581 Peters J, et al. Cell. 2016. PubMed PMID: 27238023 Listen to the podcast segment on the B. subtilis...
  5. AAV Production in HEK293 Cells

    Type
    Protocol
    ...Corning 3319, 3180 cm 2 Cellstack 2, Corning 3269, 1272 cm 2 Heat-inactivated FBS (HI-FBS) Pro-Tip Different...
  6. Validated gRNA Sequences

    Type
    Collection
    ...GTGGCGTGACCTGTGGATGCTG 51025 visualize S. pyogenes 24360272 Qi MYOD1 H. sapiens TGGCCTCCCTCCCTGCCCGGTAG 64138...GTTAGGGTTAGGGTTAGGGTTA 51024 visualize S. pyogenes 24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313...beijerinckii CGAGTTAGACATAATAGTGA 73228 nick S. pyogenes 27213844 Yang RIPK1 H. sapiens GCTCTGCTGGGAAGCGAATC 75163...
Showing: 21 - 40 of 55 results