...active or “on.” Dronpa’s color thus indicates MEK1’s current state (Green when off, dark when on). Figure...

...Many thanks to our guest blogger Gary McDowell! Gary S. McDowell is currently the Executive Director of Future...

...Invitrogen) S. cerevisiae GAL1 promoter, forward primer Gal10pro-F GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG... reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG...promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer OpIE2 Forward... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer pGP704-R AACAAGCCAGGGATGTAACG...

...and pathology. Mohanty et al. Proc Natl Acad Sci U S A. 2023 Aug 22. Use a lentiviral FRET-based reporter...

...unavailable, you will need to design and clone in a gRNA(s) to guide the Cas9 protein to your target sequence...

...//doi.org/10.1089/hum.2019.277 Joung J, Konermann S, Gootenberg JS, Abudayyeh OO, Platt RJ, Brigham MD...

...time that were not previously possible.   Bensussen S, et al., iScience 2020. https://doi.org/10.1016/j....

...science.aaa5945. PubMed. DiCarlo, J. E., Chavez, A., Dietz, S. L., Esvelt, K. M. & Church, G. M. RNA-guided gene...

... Resources References Kwart, D., Paquet, D., Teo, S. et al. Precise and efficient scarless genome editing...

...overlapping markers. Compensation/reference control(s) Compensation or “reference” controls are samples ...

...interactive images of their proteins. Since the 1980’s, journal articles have been filled with impressive...

...lentiviral backbone from the Zhang lab expressing S. pyogenes Cas9 and a gRNA cassette. It can be used...

... http://abt.ucpress.edu/content/79/3/208 2. Fire, S. Xu, M.K. Montgomery, S.A. Kostas, S.E. Driver, C....

...and other required enzymes, including a glutathione S-transferase homolog from a Janthinobacterium sp. Moreover...

...3308701. Find the BioID Plasmids Here! Macneill, S., & Varnaitė, R. (2016). Meet the neighbors: Mapping...

...https://doi.org/10.1016/j.neuron.2013.08.032.  Morita S, Noguchi H, Horii T et al. (2016) Targeted DNA demethylation...

...in drug discovery. References 1. Baird, Geoffrey S., et al. "Circular permutation and receptor insertion...

... also let us know! Sometimes those few “thank you”s are what get a customer service agent through a busy...

...Pubmed Central PMCID: PMC4866822. 3. McDowell, Gary S., et al. "Shaping the Future of Research: a perspective...

...their useful reagents shared via Addgene. Narayan S, et al. Cell Reports. 2017. PubMed PMID: 28813671 ...the popular type II CRISPR systems, which include S. pyogenes (Spy) Cas9, been identified. In Rauch, et...