...to stars in space ships and the rise of killer machines that exterminate entire humanity were the two ... technologies rely on the cellular DNA repair machinery, which can lead to high frequency of indel formation... the use of molecular dynamics simulations and machine learning to develop a predictive understanding ...

...membrane hyperpolarization but unlike HR, this is achieved through hydrogen ion efflux; evidence suggests...expression of your opsin is no longer required to achieve cell-type specific opsin expression. However, the...Cellular and Molecular Biology from the University of Michigan and he is currently a Postdoctoral Fellow in the...

...Purify Genomic Regions The enChIP (engineered DNA-binding molecule-mediated ChIP) system, developed by the...the DNA, to create a DSB enChIP En gineered DNA-binding molecule-mediated ChIP , using a tagged-dCas9+gRNA...the ways the CRISPR components are leveraged to achieve specific goals, such as targeting multiple genomic...HDR) pathway. HDR relies on copying DNA from a matching template to accurately repair or fill in the missing...gRNAs into a single plasmid — though some have achieved targeting in the double digits. These multiplex...nickase system is utilized in many CRISPR systems to achieve specific genetic edits. The dCas9 molecule binds...or G, Y = C or T SpRYc - SpRY PAMs plus NNG; a chimeric version of SpRY Though these PAM-flexible Cas9s...

...pluripotency of mouse cells typically involves making chimeras by injecting iPSCs into blastocysts and implanting...implanting them into female mice. Generating chimeric offspring shows the ability of the iPSC to contribute... three germ layers, and the ability of theses chimaeras to produce all-iPSC derived offspring demonstrates...

... Special considerations One type of ChIP assay, called native ChIP, does not use cross-linking and instead...accessible to antibodies. Detection of sdAbs is usually achieved by conjugation of a signaling molecule directly...can be detected either digitally by an imaging machine or by X-ray film. HRP cannot be used to distinguish...detect simultaneously. Conjugation The process of attaching signaling molecules to an antibody is done through...Immunoprecipitation (IP) Chromatin immunoprecipitation (ChIP) Visualization - used to visualize protein location...either X-ray film in a darkroom or an image capture machine. Special considerations The primary antibody must...immunoprecipitation (IP) and chromatin immunoprecipitation (ChIP) allow you to isolate specific proteins or protein...

...Nishida, K., Arazoe, T., Yachie, N., Banno, S., Kakimoto, M., Tabata, M., Mochizuki, M., Miyabe, A., Araki...sites previously difficult to target. ABE8s can achieve 98-99% target modification in primary T cells, ...

...strength, and binding (e.g. DHS-seq, FAIRE-seq, and CHIP-seq), genome-wide identification and quantification...to test multiple expression systems before they achieve the appropriate expression level for their gene...cloning process alone involves much literature searching, DNA synthesis, and plasmid assembly. Luckily,...genome-engineering endeavours of unparalleled complexity in Escherichia coli, like the construction of a so-called “genomically...

...channels- chimeras C1C2 ChR1-ChR2 chimera 470 ChIEF, ChEF, ChD Engineered by chimeragenesis of ChR1 and...genetic point mutations, codon optimization, and chimeric fusion of domains from two different ChRs. These...photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ChIEF Increased channel (on/off) kinetics: Examples: ChETA...and ChR2 450-470 C1V1 ChR1-VChR1 chimera with E122T and E162T mutations 540 Channelrhodopsins: chloride...inhibitory ChR with mutation C128A (derived from C1C2 chimera) 475 GtACR Chloride-conducting channel from Guillardia...Generally, the most robust and stable expression is achieved in a transgenic mouse line, such as for example...targets into large, optically assembled protein architectures in living mammalian cells. LITE Two-hybrid system...

...incorporates a bioluminescence protein into the chitin that can be activated only by a specific frequency...Additional resources on the Addgene blog:  Flies 101: Catching flies in the lab References Abril, U.N.O., et....

...Plant Breeding, Genetics, and Biotechnology at Michigan State University with the backing of a prestigious...:47-9:35 : Kingdom's biotechnology research at Michigan State University 9:36-10:29 : Kingdom's transition...

...organizing Halloween festivities for years – searching our photo archives I found pictures back through 2009, ...

... your own depositor metrics!  About the Author Joachim Goedhart is an assistant professor at the Section...fluorescent probes. You can follow him on twitter: @joachimgoedhart.    ...

...AAV9 Biosensors Patriarchi New viral service pAAV_hSyn1_nLightR AAV9 Biosensors Patriarchi New viral service...

...MerryChristmas #happyholidays2018 #DeckTheLab @Addgene @joachimgoedhart @SAbiega @EikeMahlandt @Saskia_deMan @AnoeskaMoosdijk...Fireplace from the Dyer Lab If you’re feeling as chilly this winter as the Addgenies are in Massachusetts...

...ending the day with 1,000,002 plasmids shipped. Reaching one million plasmids shared might have you wondering...colossal 547 years! While we are very excited about reaching this milestone, it wouldn’t have been possible...

...was a fantastic month for the Addgene blog. We achieved roughly 50,000 views over the entire blog and ... Expression in Mammals Recombinase-based State Machines Enable Order-dependent Logic in vivo As always...

...lab equipment to carefully-screened research and teaching departments at universities around the world. ...the Addgene Blog Learn About Our Recent Visit to China Read Zafira Castano Corsino’s Recent Post on the...

... DSHB was created by the National Institute for Child Health and Human Development (NICHD) in 1986, to...toxic adjuvants; 2) generating complex antibody chips that allow assessment of many protein targets in...

...establish.These funding decisions will have far-reaching consequences throughout the scientific community... can turn to Addgene as a trusted partner for archiving their biological materials during funding transitions...

...reverse primer pTrcHis Forward GAGGTATATATTAATGTATCG (Invitrogen) 5' of MCS in pTrcHis vector, forward...forward primer pTrcHis Reverse GATTTAATCTGTATCAGG (Invitrogen) 3' of MCS in pTrcHis vector, same as pBAD-R,...List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'...5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward primer 35S promoter...Forward CAATTTACATCTTTATTTATTAACG (Invitrogen) For Pichia vectors with AUG1 promoter, forward primer AUG1...Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1 promoter, reverse primer BGH ...