Skip to main content
Addgene
Showing: 241 - 254 of 254 results

  1. Validated gRNA Sequences

    Type
    Collection
    ...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...23287722 Church AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens... 26997482 Yeo AAVS1 H. sapiens TGTCCCTAGTGGCCCCACTG cut S. pyogenes 26789497 Corn AAVS1 H. sapiens ACAGTGGGGCCACTAGGGAC...GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758 Sabatini AAVS1 H. sapiens GTCCCCTCCACCCCACAGTG 41817 cut S. pyogenes...GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 72833 cut S. pyogenes...

  2. CRISPR Plasmids - Tagging

    Type
    Collection
    ...targeting the AAVS1 locus. Doyon Tagging Plasmid: 3xFLAG-2xSTREP Construct for integrating at the AAVS1 "safe ...cloned directly into this vector and targeted to the AAVS1 genomic safe harbor locus using untagged SpCas9 ...Addgene 41815 or #44719 ) in combination with gRNA_AAVS1-T2 (Addgene #41818) or using an all in one vector...vector from the Doyon lab, eSpCas9(1.1)_No_FLAG_AAVS1_T2 (Addgene #79888) , which expresses an untagged...safe harbor" locus: eSpCas9(1.1)_No_FLAG_AAVS1_T2 Doyon Lab TAP Tagging Protocol 97.2 KB Yamamoto PITCh Tagging...

  3. Church Lab CRISPR Plasmids

    Type
    Collection
    ...cut DNA 41817 gRNA_AAVS1-T1 A gRNA to human AAVS1 41818 gRNA_AAVS1-T2 A gRNA to human AAVS1 41819 gRNA_GFP-T1...

  4. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP NA Cytoplasm 101781 CETN2-...mEGFP Ras-related protein Rab-5A Endosomes 107580 AAVS1-mTagRFPT-CAAX AICSDP-42 mTagRFPT CAAX domain of ...AICSDP-29 mTagRFPT Lamin B1 Nuclear envelope 114404 AAVS1-mEGFP (PGK) AICSDP-36 mEGFP NA Cytoplasm 114405 ...

  5. Let There Be LITE Plasmids

    Type
    Blog Post
    ...offers a tip: save yourself some time by making an AAV1 supernatant. (The details can be found here.) So...

  7. Hot Plasmids - October 2022

    Type
    Blog Post
    ...available as Cre-dependent, EF1ɑ-driven viral vectors (AAV1) - and you can also find several other constructs...

  12. Bioinformatics at Addgene

    Type
    Blog Post
    ...SeqwellHow to Keep a Lab Notebook for Bioinformatics AnalysesAAV Vector Quality Control: Going the Extra Mile ...
Showing: 241 - 254 of 254 results