Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 20 of 32 results
  1. New Viral Vectors - Summer 2024

    Type
    Blog Post
    ...pAAV-Ef1a-fDIO-ChrimsonR-tdTomato AAV9 Controls Jensen New serotype pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA AAV9...multiple serotypes pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] AAV5, AAV8 Optogenetics Boyden New serotypes...
  2. Teaching an Old DOG New Tricks: Controlling Protein Activity with GFP

    Type
    Blog Post
    ...used red fluorescent proteins dsRed, mCherry, and TdTomato do not induce transcription. Thus, T-DDOGs can...expression robustly activated the reporter gene TdTomato, whose expression was absent without electroporated...T-DDOGs with two mouse GFP reporter lines; again, TdTomato was seen only in cells with GFP, at a high activation...frequency of 56-93%. In the converse test, 98% of TdTomato expressing cells were GFP+, indicating a robust...
  3. New and Upcoming Viral Vectors - Spring 2019

    Type
    Blog Post
    ...pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] pAAV-FLEX-tdTomato pAAV-GFAP104-mCherry pAAV-mDlx-NLS-mRuby2 CAG-...fluorescent-tagged molecular tool.   Find pAAV-FLEX-tdTomato, pAAV-GFAP104-mCherry, pAAV-mDlx-NLS-mRuby2, CAG-NLS-GFP... pAAV-hSyn-DIO-mCherry 59462  AAV2  pAAV-CAG-tdTomato (codon diversified) 37825  AAV8*, AAV9*  pAAV-CAG-GFP...
  4. Newly Updated AAV Data Hub!

    Type
    Blog Post
    ...AAV1 Cre virus combined with a Cre-dependent AAV9 tdTomato virus in the mPFC.  The AAV9 is so strong that...
  5. Hot Plasmids - October 2022

    Type
    Blog Post
    ... cations. B) Cortical slice of HcKCR1-EYFP and tdTomato expressed layer 2/3 neurons in mouse. C) Action...
  6. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...pAdx-CMV-iCre-P2A-tdTomato 73351 Expresses iCre and tdTomato from the CMV promoter pAdxEF1-FLPe-tdTomato 73352 Expresses...expressed by another vector pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed...pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 NOT AVAILABLE YET Cre is coexpressed with tdTomato and Pac (puromycin... CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...expressed by another vector pCDH-EF1-Fon-tdTomato 72261 Expresses tdTomato from the EF1 promoter when FLP is ...EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7-...copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses tdTomato from the CMV promoter pAdx-CMV-YFP...
  7. Control AAV Preps

    Type
    Collection
    ...MaCPNS2 Boyden 44332 pZac2.1 gfaABC1D-tdTomato gfaABC1D tdTomato Constitutive 5 Khakh 50465 pAAV-hSyn-...rg*, PHP.eB Roth 51506 AAV phSyn1(S)-tdTomato-WPRE hSyn tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104...mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB,...Deisseroth 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Constitutive 9, PHP.eB Feng Cre-dependent...2, 5, 9, rg* Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9, rg*, PHP.eB..., 2, 9 Deisseroth 128434 pAAV-Ef1a-fDIO-tdTomato EF1a tdTomato Flp dependent 1 Jensen 99133 pAAV-CAG-fDIO-mNeonGreen...
  8. Optogenetics AAV Preps

    Type
    Collection
    ...Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Svoboda 75470 pAAV-CAG-FLEXFRT-ChR2...Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR...ChrimsonR tdTomato Cre dependent 5 Boyden 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato...Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Jensen 174007 pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST...dependent 1, 9 Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato Cre dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP...Boyden 84446 pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] CAG Jaws tdTomato Cre dependent 1, 8 Boyden Inhibitory...
  9. Caltech Systemic Capsids

    Type
    Collection
    ...pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Control...Description Category PI Controls 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 37825 pAAV-CAG-GFP...CamKIIa EGFP Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 83900 pAAV-mDlx-GFP-Fishell...
  10. Sequencing Primers

    Type
    Guide
    ...forward primer tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT...TCTTTGATGACGGCCATGT 5' end of tdTomato, reverse primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance...
  11. Cre-lox system

    Type
    Collection
    ...AAV Simpson 72255 pCDH-CB-iCre-P2A-tdTomato-T2A-Puro iCre and tdtomato CB Mammalian Oka 72256 pCDH-CB-copGFP-T2A-iCre...Adenoviral Oka 73351 pAdx-CMV-iCre-P2A-tdTomato iCre and tdTomato CMV Adenoviral Oka 73472 RabV CVS-N2c...Insect Rubin 51503 AAV pCAG-FLEX-tdTomato-WPRE Cre dependent TdTomato expression AAV Zeng 60877 pMAZe ...hsp70 Xenopus Ryffel 30525 pBSHSP:Cre;CMV:tdTomato-SceI Cre and tdTomato coexpression Xenopus hsp70 Xenopus... Mammalian Cepko 69916 pAAV.cTNT.iCre iCre and tdtomato Chicken cardiac troponin T AAV Pu 70120 pEMS2159...inserting promoter none Mammalian Heller 112617 ptdTHC tdTomato and Cre-ERT2 with MCS for inserting promoter none...Cre-ERT2 CAG Mammalian Heller 112621 pCAG-tdTHC tdTomato, Cre-ERT2 CAG Mammalian Heller 112622 pVHC_PGKneoLox2DTA...
  12. Retrograde AAV viral preps

    Type
    Collection
    ...Cre-dependent Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 50457 pAAV-hSyn-DIO-EGFP ...Flp-dependent Control Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 27056 pAAV-Ef1a-DIO...Optogenetics Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG Activator Optogenetics Svoboda 26975 pAAV-...
  13. AAV Molecular Tools

    Type
    Collection
    ... Activity Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent...Cre-dependent expression of cytoplasmic tdTomato and synaptophysin-EGFP for labeling of axon terminals....
  14. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng...Wilson AV-5-PV3106 44332-AAV5 pZac2.1 gfaABC1D-tdTomato Baljit Khakh AV-8-PV0101 105530-AAV8 pAAV.CMV....Optogenetics AV-1-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-1-20071P 20071-AAV1 pACAGW-ChR2...Deisseroth AV-5-PV2510 28305-AAV5 pAAV-FLEX-ArchT-tdTomato Ed Boyden AV-5-PV2527 99039-AAV5 pAAV-CamKII-ArchT-GFP... Kim AV-10-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-10-PV1963 105542-AAV1 pENN.AAV.CB7...Wilson AV-5-18917P 18917-AAV5 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2...Sternson AV-9-18917P 18917-AAV9 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-PV2432 22222-AAV5 AAV-FLEX-Arch-GFP...
Showing: 1 - 20 of 32 results