Skip to main content
Addgene
Showing: 1 - 20 of 424 results
  1. Kit Free RNA Extraction

    Type
    Protocol
    ...seconds. Incubate sample(s) for 15 minutes on ice and centrifuge the sample(s) for 15 minutes at 12,000...mL of Solution D per 1 X 10 7 cells. Allow sample(s) to sit at room temperature for 5 minutes to allow...the cells. Extract RNA from the homogenized sample(s).Transfer tissue/cell lysate to a 4 mL tube. Add the...aiming your tip in the tube. Precipitate your sample(s). You can use either Isopropanol or Lithium Chloride...Quantify and assess the quality of your RNA sample(s) using a spectrophotometer (such as a Nanodrop), agarose...which can be modified for RNA. Store your RNA sample(s) at -80 °C to prevent RNA degradation and avoid multiple... 1 mL of TRIzol® per 1 X 10 7 cells. Allow sample(s) to sit at room temperature for 5 minutes to allow...
  2. Molecular Biology Protocol - Restriction Digest of Plasmid DNA

    Type
    Protocol
    ...tube combine the following: DNA Restriction Enzyme(s) Buffer BSA (if recommended by manufacturer) dH 2 ...purifying it, you may need to inactivate the enzyme(s) following the digestion reaction. This may involve...digesting a large number of plasmids with the same enzyme(s) (for instance, in a diagnostic digest), you can create...
  3. Transfection for Recombinant Antibodies

    Type
    Protocol
    ...tube of 6 mL BCD TFX. Cap the tube and vortex for 5 s to mix. Add 450 µL of 1 mg/mL PEI-MAX to the second..., 450 µg = 450 µL). Cap the tube and vortex for 5 s to mix. Pro-Tip The optimal ratio of DNA:PEI may vary...diluted DNA. Cap the tube and vortex with three 1 s pulses. Incubate for 3 min at room temperature. Transfer...
  4. Protocol - How to Perform a Diagnostic Digest

    Type
    Protocol
    ... size insert. By selecting the appropriate enzyme(s), one can either linearize a plasmid to determine ...therefore the only thing left to do is identify the clone(s) in which the insert is in the correct orientation...
  5. AAV Purification by Iodixanol Gradient Ultracentrifugation

    Type
    Protocol
    ...use of phenol red. Image adapted from Zolotukhin, S., et al. "Recombinant adeno-associated virus purification...purified AAV. Left image adapted from Zolotukhin, S., et al. "Recombinant adeno-associated virus purification...
  6. Validated gRNA Sequences

    Type
    Collection
    ...41817 cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes...ade6-L469 S. pombe TCTATTGTTCAGATGCCTTG 52227 cut S. pyogenes 25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG... 52226 cut S. pyogenes 25352017 Zaratiegui ade6+ S. pombe TCTATTGTTCAGATGCCTCG 52225 cut S. pyogenes 25352017...70655 cut S. pyogenes 26472758 Sabatini CAN1 S. cerevisiae GATACGTTCTCTATGGAGGA 43803 cut S. pyogenes ...interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate S. pyogenes...promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes...
  7. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...none S. pyogenes Gao pZmU3-gRNA 53061 Plant none S. pyogenes Gao pU6-gRNA 53062 Plant BbsI none S. pyogenes...vector was designed to be used with, such as S. pyogenes, S. aureus, N. meningitidis, etc. gRNA scaffolds...Bacteria BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...HindIII none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein.... elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion...BspQI yes, cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...Mammalian AfIII none S. pyogenes Bleocin Church MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA...
  8. CRISPR Plasmids - Plants

    Type
    Collection
    ...:AtU6p aU6 BsaI none S. pyogenes Kamoun 52255 pUC119-gRNA U6 PCR template none S. pyogenes Sheen 51295...rice snoRNA U3 BsaI none S. pyogenes Yang 50579 pBUN6A11 OsU3 BsaI yes, activate S. pyogenes Bar Chen 50580... BsaI yes, interfere S. pyogenes Bar Chen 50582 pBUN501 AtU6-26 BsaI yes, nick S. pyogenes Bar Chen 50594...pCBC-MT2T3 see paper BsaI none S. pyogenes Chen 50595 pCBC-MT3T4 see paper BsaI none S. pyogenes Chen 62204 pBUN421...pBUN421 TaU3 BsaI yes, cut S. pyogenes Bar Chen 53063 pU3-gRNA OsU3 AarI none S. pyogenes Gao 53061 pZmU3...pZmU3-gRNA maize U3 none S. pyogenes Gao 53062 pU6-gRNA wheat U6 BbsI none S. pyogenes Gao 59188 pBlu/gRNA...gRNA Arabidopsis U6 BbsI none S. pyogenes Stupar 62200 pBUE411 OsU3 yes, cut S. pyogenes Basta Chen 62203...
  9. CRISPR Guide

    Type
    Collection
    ...23287722 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., Barrangou,...Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T., Abudayyeh, O. O., Gootenberg, J. S., Mori, H...Chandrasekaran, S. S., Perry, N. T., Schaepe, J., Du, P. P., Lotfy, P., Bassik, M. C., Bintu, L., Bhatt, A. S., & ...PMID: 38216671 Klompe, S. E., Vo, P. L. H., Halpin-Healy, T. S., & Sternberg, S. H. (2019). Transposon-encoded...Scheiman, J., Vora, S., Pruitt, B. W., Tuttle, M., Iyer, E. P. R., Lin, S., Kiani, S., Guzman, C. D., Wiegand..., E. C., Newberry, K. M., Smith, S. B., Meadows, S. K., Roberts, B. S., Mackiewicz, M., Mendenhall, E....Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung...
  10. Recombinases AAV Preps

    Type
    Collection
    ... ID Name Promoter Fluorophore Serotype(s) PI 50363 AAV phSyn1(S)-DreO-bGHpA Syn none 5, rg* Zeng Flpo ... ID Name Promoter Fluorophore Serotype(s) PI 51669 AAV phSyn1(S)-FlpO-bGHpA Syn none rg* Zeng 174378 pAAV-syn-Flpo...VCre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 55638 pAAV-EF1a-vCre EF1a none 8, rg* Deisseroth...Cre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII...Recombinases ID Name Promoter Fluorophore Serotype(s) PI 140135 pAAV-EF1a-iCreV EF1a none 1, PHPeB Zeng...
  11. Typing CRISPR Systems

    Type
    Blog Post
    ....2017.05.008 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., Barrangou,... Makarova, K. S., Wolf, Y. I., Iranzo, J., Shmakov, S. A., Alkhnbashi, O. S., Brouns, S. J. J., Charpentier...H., Kannan, S., Suberski, A. J., Mears, K. S., Demircioglu, F. E., Moeller, L., Kocalar, S., Oshiro, R...Keston-Smith, E., Sothiselvam, S., Garrity, A. J., Chong, S., Makarova, K. S., Koonin, E. V., Cheng, D. R...References Abudayyeh, O. O., Gootenberg, J. S., Essletzbichler, P., Han, S., Joung, J., Belanto, J. J., Verdine...Barrangou, R., Brouns, S. J. J., Charpentier, E., Haft, D. H., Horvath, P., Moineau, S., Mojica, F. J. M., Terns..., D. H., Horvath, P., Moineau, S., Mojica, F. J. M., Scott, D., Shah, S. A., Siksnys, V., Terns, M. P....
  12. COVID-19 Resources

    Type
    Collection
    ...key step is the priming of the S protein by host cell proteases. The S protein of SARS-CoV-2 is primed...Libraries SARS-CoV-2 Spike (S) Ectodomain and RBD Libraries - Libraries of Spike (S) Ectodomain and RBD mutants... MERS CoV, depends on binding of the viral spike (S) protein to cellular receptors. The cellular receptor...Libraries - Yeast surface display libraries of Spike (S) Ectodomain and RBD mutants that can be used to identify...TMPRSS2 - a serine protease that primes the SARS-CoV-2 S protein and is involved in virus entry into cells....proteins to a biologically active state. The SARS-CoV-2 S protein contains a potential cleavage site for furin...immunoglobulin superfamily, binds to the SARS-CoV-2 S protein and is involved in virus entry into cells....
  13. K. phaffii: Rising to the Occasion

    Type
    Blog Post
    ...it grows fast to boot. The yeast strains S. cerevisiae and S. pombe have dominated the research scene....the most frequently used yeast strains: S. pombe (fission) and S. cerevisiae (budding). Yeast make for ...probably wondering if the “biotech yeast” is S. pombe or S. cerevisiae. Actually, it’s neither. The most...phaffii and other yeast strains.     S. cerevisiae S. pombe K. phaffii Growth properties ...glycerol). K. phaffii is only distantly related to S. pombe and S. cerevisiae; evolutionarily it evolved much... K. phaffii to work   The yeast giants - S. cerevisiae and S. pombe - aren’t going anywhere anytime soon...Amenable to genetic manipulation The first eukaryote (S. cerevisiae) to have its genome fully sequenced There...
  14. Degrading DNA with Cascade-Cas3

    Type
    Blog Post
    ...0 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., Barrangou,...Toh, M. S., Irby, M. J., Edwards, L. S., Lin, C., Owen, A. L. G., Künne, T., . . . Sternberg, S. H. (2019...Cas3’s degradative power in the future! References and Resources References Loeff, L., Brouns, S. J.,... H., Sasakawa, N., Naito, Y., Nakada, S., Yamamoto, T., Sano, S., Hotta, A., Takeda, J., & Mashimo, T....x Cameron, P., Coons, M. M., Klompe, S. E., Lied, A. M., Smith, S. C., Vidal, B., Donohoue, P. D., Rotstein...Barrangou, R., Brouns, S. J. J., Charpentier, E., Haft, D. H., Horvath, P., Moineau, S., Mojica, F. J. M., Terns...through the Cas3. This mechanism is important for Cas3’s biggest trick. Cas3 likes to bluff, making you into...
  15. Plasmids 101: Yeast Vectors

    Type
    Blog Post
    ...source. S. cerevisiae  no no   LEU2 L-leucine no S. cerevisiae yes - This can complement leu1- S. pombe...L-hisitidine no S. cerevisiae  no yes   URA3 pyrimidine (uracil) yes - Grow with 5-FOA. S. cerevisiae yes... ura4+. leu1+ L-leucine   S. pombe  no no   ade6+ purine (adenine)   S. pombe  no no   Considerations...are included (reviewed here). Plasmids for use in S. pombe, on the other hand, do not require a well defined...sequence) dictate the replication of these vectors. S. pombe plasmids oftentimes utilize an ARS to aid in... yes - This can complement ura4- S. pombe, but the complementation is weak. yes   LYS2 L-lysine yes ... yes   TRP1 L-tryptophan yes - Grow with 5-FAA. S. cerevisiae no  no TRP1 alters some yeast phenotypes...
  16. CRISPR References and Information

    Type
    Collection
    ...that identifies putative target sites for S. pyogenes Cas9, S. thermophilus Cas9, or Cpf from your input...checks for off-target binding and can work for S. pyogenes, S. thermophilus or N. meningitidis Cas9 PAMs....position of the observed mutations. Coding sequence/s may be provided to quantify frameshift and potential...support for bacteria ( E. coli, B. subtilis ), yeast ( S. cerevisiae ), worm ( C. elegans ), fruit fly, zebrafish...and news featured on Addgene's blog Protocols Lab(s) Description Plasmids in protocol Download protocol...gRNA: pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s) PDF 47.5 KB Vosshall and Matthews CRISPR/Cas9 reagent...
  17. p53 Pathway

    Type
    Collection
    ...ageing-associated phenotypes. Tyner SD, Venkatachalam S, Choi J, Jones S, Ghebranious N, Igelmann H, Lu X, Soron G...papillomavirus). These mutations interfere with p53’s ability to activate transcription, and they also have...through oligomerization. In particular, the loss of p53’s pro-apoptotic effects is especially important to tumorigenesis...kinase ATR ATR serine/threonine kinase B99 G-2 and S-phase expressed 1; also known as GTSE1 BAI-1 Brain-specific... human malignancy: a clinical perspective. Surget S, Khoury MP, Bourdon JC. Onco Targets Ther. 2013 Dec...
  18. A Needle in a Base-Stack: Cas9 Structural Biology

    Type
    Blog Post
    ...Osuka, S., Isomura, K., Kajimoto, S., Komori, T., Nishimasu, H., Shima, T., Nureki, O., & Uemura, S. (2018... J. P. K., Liu, M.-S., Hibshman, G. N., Dangerfield, T. L., Jung, K., McCool, R. S., Johnson, K. A., &...Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I., Dohmae, N., Ishitani, R., Zhang, F., &...://doi.org/10.1038/nature15544 Sternberg, S. H., Redding, S., Jinek, M., Greene, E. C., & Doudna, J. A....   Figure 1: A cartoon depiction of Cas9’s two major lobes, REC and NUC, and their subdomains...pyogenes.   Figure 2:  Crystal structure of S. pyogenes Cas9 in the apo state (PDB ID 4CMP) with...can offer more information on these regions.   Cas9’s transition from weak, random binding to precision ...
  19. Viral Vectors 101: AAV Serotypes and Tissue Tropism

    Type
    Blog Post
    ...B.-Y., Viswanathan, S., Gaj, T., Lavzin, M., Ritola, K. D., Lindo, S., Michael, S., Kuleshova, E., Ojala...resources References Aschauer, D. F., Kreuz, S., & Rumpel, S. (2013). Analysis of transduction efficiency...https://doi.org/10.1016/j.omtm.2022.07.010 Issa, S. S., Shaimardanova, A. A., Solovyeva, V. V., & Rizvanov...10.1128/jvi.75.15.6884-6893.2001 Pillay, S., Meyer, N. L., Puschnik, A. S., Davulcu, O., Diep, J., Ishikawa,...Stanton, A., King, E. M., Ye, S., Tellez, L., Krunnfusz, A., Tavakoli, S., Widrick, J. J., Messemer, K...j.neuron.2016.09.021 Walters, R. W., Yi, S. M., Keshavjee, S., Brown, K. E., Welsh, M. J., Chiorini, J..., Rehman, K. K., Bertera, S., Zhang, J., Chen, C., Papworth, G., Watkins, S., Trucco, M., Robbins, P. ...
Showing: 1 - 20 of 424 results