-
Plasmid#1186DepositorInserthtt 103Q (HTT Human)
UseTagsGFPExpressionYeastMutationPromoterAvailable sinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
pcDNA6.2 EmGFP hAQP4(M23)
Plasmid#126464PurposeExpresses human AQP4 (isoform M23) as an EmGFP fusion protein in mammalian cellsDepositorInsertAquaporin 4 (AQP4 Human)
UseTagsEmGFPExpressionMammalianMutationPromoterAvailable sinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA
Plasmid#73796PurposepRS416 Ura marked Cen/Ars plasmid with dCas9-Mxi1 under Tef1 promoter, and tet-incucibile RPR1 promoter with NotI cloning site adjacent to gRNADepositorInsertsdCas9-Mxi1
Tet Repressor
Structural gRNA for S pyogenes
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1, pRPR1(TetO), and pTef1Available sinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHEE2E-TRI
Plasmid#71288PurposeEgg cell-specific promoter-controlled expression 3×FLAG-NLS-zCas9-NLS and two sgRNAs targeting three genes: ETC2, TRY, and CPCDepositorInsertssgRNA targeting TRY and CPC genes
sgRNA targeting ETC2 gene
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgSEC61B.N1-CAG-Cas9-T2A-mCherry-P2A-Puro
Plasmid#216251PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and sgSEC61B.N1 to tag endogenous SEC61B N-terminusDepositorInsertCas9 and sgSEC61B.N1 (SEC61B Human)
UseCRISPRTagsExpressionMammalianMutationPromoterCAGAvailable sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZE21/UBP1/ClpS_V65I
Plasmid#98567PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and the V65I engineered variant of E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
Mutated ATP-dependent Clp protease adapter protein
UseTagsExpressionBacterialMutationContains the V65I mutation that increases discrim…PromoterAvailable sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-p110 CUX1
Plasmid#100816PurposeGateway lentiviral vector expressing p100 CUX1 (amino acids 747-1505 of P39880), with an N-terminal Myc tag and a C-terminal HA tagDepositorInsertHs CUX1 amino acids 747-1505 of P39880 (CUX1 Human)
UseLentiviralTagsHA and mycExpressionMammalianMutationcontains amino acids 747-1505PromoterAvailable sinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-IRES_ECFP
Plasmid#48354PurposeContributes an IRES-ECFP cassette as the 3’-module during MultiSite Gateway cloning of a bi-cistronic mRNA shared with a two-part fusion protein encoded by the 5′- and middle modules.DepositorInsertIRES_ECFP
UseGateway entry vectorTagsExpressionMutationECFP translation is mediated by an IRES. Contains…PromoternoneAvailable sinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737
Plasmid#222472PurposeLuciferase vector containing the hs737 enhancer sequence (reference sequence).DepositorInserths737 enhancer (reference sequence) (LOC110120928 Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNB1-LOX
Plasmid#154058PurposeLevel 1, Position 3 Golden Gate vector. ZmUbi-5'UTR:loxP-GUS-nosT-loxP-NAM-B1-nosTDepositorInsertLoxP-flanked GUS and TtNAM-B1
UseSynthetic BiologyTagsExpressionBacterialMutationThe TtNAM-B1 gene sequence was domesticated to re…PromoterZmUbiAvailable sinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-PR.CC9
Plasmid#192932PurposepShuttle.CC9 encoding sgRNAs targeting Trp53 and Rb1 genesDepositorUseGateway-compatible vectorTagsExpressionMutationPromoterU6Available sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.3
Plasmid#222475PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 3). Variant 3 is chr10:128569437-G-A where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 3) (LOC110120928 Human)
UseLuciferaseTagsExpressionMutationVariant 3 is chr10:128569437-G-A where the inform…PromoterAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.2
Plasmid#222474PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 2). Variant 2 is chr10:128569418-T-C where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 2) (LOC110120928 Human)
UseLuciferaseTagsExpressionMutationVariant 2 is chr10:128569418-T-C where the inform…PromoterAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HDRT-TRAC-CD19.CAR-Cas12a.PAM.mutated
Plasmid#215769Purposeencodes for HDR template for optimized AsCas12a-mediated knock-in of a CD19-specific CAR into the TRAC locusDepositorInsertsUseTagsExpressionBacterialMutationCas12a PAM mutatedPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGGG-Sr43
Plasmid#186974PurposeSr43 is a wheat stem rust resistance gene transferred from tall wheat grass (Thinopyrum ponticum) into bread wheat (Triticum aestivum).DepositorInsertSr43
UseTagsNoneExpressionBacterial and PlantMutationNonePromoterNaticeAvailable sinceApril 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAd-PR.Cre
Plasmid#192936PurposeAdenoviral expression vector encoding sgRNAs targeting Trp53 and Rb1 and CreDepositorUseAdenoviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pShuttle-PRL.Cre
Plasmid#192934PurposepShuttle.Cre encoding sgRNAs targeting Trp53, Rb1 and Rbl2 genesDepositorUseGateway-compatible vectorTagsExpressionMutationPromoterU6Available sinceDec. 9, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pShuttle-PR.Cre
Plasmid#192933PurposepShuttle.Cre encoding sgRNAs targeting Trp53 and Rb1 genesDepositorUseGateway-compatible vectorTagsExpressionMutationPromoterU6Available sinceDec. 9, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits