-
Plasmid#52294Purposebacterial expression of human SPOP (aa 28-337) fused to His-MBPDepositorInsertSPOP (SPOP Human)
UseTagsHis-MBP and TEVExpressionBacterialMutationPromoterT7Available sinceApril 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau7-12WT
Plasmid#194166PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 7,9-12. Expresses the tau circRNA 12-->7 WT with 3X flag tag in exon 7.DepositorInsertMicrotubule-associated protein tau 7-12 WT
UseTags3X FlagExpressionMammalianMutationPromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12WT
Plasmid#194163PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 10-12. Expresses the tau circRNA 12-->10 WT with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT ZKSCAN1 intronic alu elements
UseTags3X flag tagExpressionMammalianMutationPromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg
Plasmid#73073Purposehuman E2F7 minigene (exons 11,12,13/introns cassette)DepositorInsertE2F7 (E2F7 Human)
UseTagsExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by intronsPromoterCMVAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSP1-mp53AS-6xMUT
Plasmid#20904DepositorInsertp53AS (Trp53 Mouse)
UseTagsExpressionMammalianMutationpoint mutation (Ser/Thr-Ala) of the 6 N-terminal …PromoterAvailable sinceApril 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 10-12WT
Plasmid#194167PurposeInsert contains intronic Tau authentic Alu and repeat elements. The introns are flanked by the Wild Type tau cDNA exons 10-12 . Expresses the tau circular RNA 12-->10 WT with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT
UseTags3X FlagExpressionMammalianMutationPromoterAvailable sinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 7-12WT
Plasmid#194170PurposeInsert contains intronic Tau authentic Alu and repeat elements. The introns are flanked by the Wild Type tau cDNA exons 7,9-12 . Expresses the tau circular RNA 12-->7 WT with 3X flag tag in exon 7.DepositorInsertmicrotubule-associated protein tau 7-12 WT
UseTags3x FlagExpressionMammalianMutationPromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12V337M
Plasmid#194165PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by tau cDNA exons 10-12 with FTLD-Tau V337M mutation. Expresses the tau circRNA 12-->10 V337M with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 V337M
UseTagsExpressionMammalianMutationChanged Valine 337 to MethinoninePromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_DED/AAA USP7
Plasmid#131253PurposeMammalian expression of an N-terminally Myc-tagged USP7 mutant, with mutations in UBL2 (DE758AA_D764A)DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
UseTagsMycExpressionMammalianMutationContains point mutations that convert USP7 aspart…PromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCas9_sgRNA_0
Plasmid#70763Purposeexpresses Ustilago maydis codon-optimized Cas9, contains U. maydis U6 promoter, is self-replicatingDepositorInsertsU6 promoter
cas9
tnos terminator
UseSelf-replicating in ustilago maydis, conferring c…TagsN-terminal NLS, C-terminal HA-tag +NLSExpressionMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU6 from Ustilago maydis and synthetic otef promot…Available sinceNov. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_SNORD27h_2ntmut
Plasmid#73067Purposeexpression clone for human mutated SNORD27 (C/D box snoRNA U27)DepositorInsertSNORD27 (E2F7 Human)
UseTagsno tagExpressionMammalianMutation2 nt mutation in AS box that binds E2F7 pre-mRNAPromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_PP7-tag
Plasmid#73078Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with PP7-tag on 5'-endDepositorInsertE2F7 (E2F7 Human)
UseTags5'-PP7-tag RNAExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by intronsPromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_2ntmut
Plasmid#73074Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with mutated snord27 binding siteDepositorInsertE2F7 (E2F7 Human)
UseTagsExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by introns, 2…PromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 10-12V337M
Plasmid#194169PurposeInsert: intronic Tau authentic Alu and repeat elements. Introns are flanked by the tau cDNA exons 10-12 with FTLD-Tau V337M mutant. Expresses tau circular RNA 12-->10 VM with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 V337M
UseTags3X flagExpressionMammalianMutationChanged Valine 337 to MethinoninePromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 10-12K317M
Plasmid#194168PurposeInsert: intronic Tau authentic Alu and repeat elements. Introns are flanked by the tau cDNA exons 10-12 with FTLD-Tau K317M mutant. Expresses tau circular RNA 12-->10 KM with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 K317M
UseTags3X FlagExpressionMammalianMutationChanged Lysine 317 to MethioninePromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_DW164AA 1-205 USP7
Plasmid#131254PurposeMammalian expression of a mutant USP7 TRAF-like domain (DW164AA), with an N-terminal Myc tagDepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
UseTagsMycExpressionMammalianMutationExpresses a mutant form of our pcDNA3.1-N-Myc_1-2…PromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_DW164AA + DED/AAA USP7
Plasmid#131256PurposeMammalian expression of N-terminally Myc-tagged USP7, with mutations in the TRAF-like domain (DW164AA) and UBL2 (DE758AA_D764A)DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
UseTagsMycExpressionMammalianMutationContains point mutations that convert USP7 aspart…PromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_6ntmut
Plasmid#73075Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with mutated snord27 binding siteDepositorInsertE2F7 (E2F7 Human)
UseTagsExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by introns wi…PromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_10ntmut
Plasmid#73076Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with mutated snord27 binding siteDepositorInsertE2F7 (E2F7 Human)
UseTagsExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by introns wi…PromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only