pcDNA3.1_hE2F7mg_PP7-tag
(Plasmid
#73078)
-
Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with PP7-tag on 5'-end
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73078 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1V5hisTOPO
- Total vector size (bp) 9738
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameE2F7
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4178
-
Mutationpartial gene, exons 11,12,13 spaced by introns
-
Entrez GeneE2F7
-
Tag
/ Fusion Protein
- 5'-PP7-tag RNA
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGGAAACCCTTAGACGTCAAACCCTCAGATTCCACAG
- 3′ sequencing primer TATAAACTCCTTAAAGCTTAAGGGCAATTCCACCACAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1_hE2F7mg_PP7-tag was a gift from Stefan Stamm (Addgene plasmid # 73078 ; http://n2t.net/addgene:73078 ; RRID:Addgene_73078) -
For your References section:
Dual function of C/D box small nucleolar RNAs in rRNA modification and alternative pre-mRNA splicing. Falaleeva M, Pages A, Matuszek Z, Hidmi S, Agranat-Tamir L, Korotkov K, Nevo Y, Eyras E, Sperling R, Stamm S. Proc Natl Acad Sci U S A. 2016 Mar 22;113(12):E1625-34. doi: 10.1073/pnas.1519292113. Epub 2016 Mar 8. 10.1073/pnas.1519292113 PubMed 26957605