pcDNA3.1(+)MBII85
(Plasmid
#67643)
-
PurposeMBII85 snoRNA expression cassett, contains snoRNA in natural intron surrounded by natural exons.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67643 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1(+)
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMBII85 snoRNA
-
Alt nameSNORD116
-
SpeciesM. musculus (mouse)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GGTTGCATTCCCTTTCCAGTA
- 3′ sequencing primer CATTTAACTCAGGTGACCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(+)MBII85 was a gift from Stefan Stamm (Addgene plasmid # 67643 ; http://n2t.net/addgene:67643 ; RRID:Addgene_67643) -
For your References section:
SNORD116 and SNORD115 change expression of multiple genes and modify each other's activity. Falaleeva M, Surface J, Shen M, de la Grange P, Stamm S. Gene. 2015 Jul 26. pii: S0378-1119(15)00848-3. doi: 10.1016/j.gene.2015.07.023. 10.1016/j.gene.2015.07.023 PubMed 26220404