-
Plasmid#157624PurposeMammalian cell surface expression of His- and FLAG-tagged full-length protein for binding and signaling assaysDepositorInsertKIR2DL4 (KIR2DL4 Human)
UseTags6xHis and FLAGExpressionMammalianMutationPromoterCMVAvailable sinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEMS1097
Plasmid#29028PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle201 (SLC6A5 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSExpressionMutationPromoterAvailable sinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_FL_D290V
Plasmid#98663PurposeExpresses MBP-tagged full length hnRNPA2 with D290VDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTags6xHis-MBPExpressionBacterialMutationD290VPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF467
Plasmid#88643PurposeDonor Vector containing ZNF467 transcription factor, part of the Human TFome CollectionDepositorInsertZNF467 (ZNF467 Human)
UseGateway donor vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
NC4 pCDNA3.1 VENUS WTX (1-804)
Plasmid#36959DepositorInsertWTX (AMER1 Human)
UseTagsVenusExpressionMammalianMutationPromoterCMVAvailable sinceJuly 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF280C
Plasmid#88658PurposeDonor Vector containing ZNF280C transcription factor, part of the Human TFome CollectionDepositorInsertZNF280C (ZNF280C Human)
UseGateway donor vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF436
Plasmid#88589PurposeDonor Vector containing ZNF436 transcription factor, part of the Human TFome CollectionDepositorInsertZNF436 (ZNF436 Human)
UseGateway donor vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_FL_P298L
Plasmid#104468Purposeexpress MBP-tagged full length hnRNPA2 P298LDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTagsHis-MBPExpressionBacterialMutationP298LPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF674
Plasmid#88785PurposeDonor Vector containing ZNF674 transcription factor, part of the Human TFome CollectionDepositorInsertZNF674 (ZNF674 Human)
UseGateway donor vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMG035 MBP-Axin∆BCD-His
Plasmid#154053PurposeExpresses MBP-Axin∆BCD-His (human Axin with aa465-518 deletion as a fusion protein with MBP and His- tags) in E.coliDepositorInsertAxin1 (AXIN1 Human)
UseTagsHis6 and MBPExpressionBacterialMutationPromoterTacAvailable sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF98
Plasmid#88567PurposeDonor Vector containing ZNF98 transcription factor, part of the Human TFome CollectionDepositorInsertZNF98 (ZNF98 Human)
UseGateway donor vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp8-HF_GC3opt
Plasmid#157699Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 Nsp8 under control of a tetracycline-inducible promoterDepositorInsertNsp8-HF_GC3opt (ORF1ab SARS-CoV-2)
UseTagsHis8-FlagExpressionMammalianMutationcodon optimized; gene expression was optimized by…PromoterAvailable sinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCEP4-HLA-c-myc-optiT1R3 ECD-MHC
Plasmid#113961Purposemammalian expression plasmid for c-myc-tagged human codon-optimized human T1R3 extracellular domain with signal peptide of HLA class I histocompatibility antigen A-2 alpha chain fused to a canonicalDepositorInsertT1R3 (TAS1R3 Human)
UseTagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 21-563 fused to a transmembrane tetherPromotercmvAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-LAIR2-Fc(DAPA)-AviTag-6xHis
Plasmid#156520PurposeMammalian expression of secreted protein fused to Fc(DAPA)-Avi-6xHis.DepositorInsertLAIR2 (LAIR2 Human)
UseTagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available sinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP(TE)
Plasmid#61522PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIP with TE mutationDepositorInsertFK506 binding protein 1A (FKBP1A Human)
UseTagsAIP with TE mutation (see comments), Tom20, and m…ExpressionMammalianMutationPromoterCMVAvailable sinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralTagsExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable sinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_3xFlag-6His-nsp15 (SARS-CoV-2)
Plasmid#169166PurposeBaculoviral transfer vector for the expression of SARS-CoV-2 nsp15 in insect cellsDepositorInsert3xFlag-6His-nsp15 (ORF1ab SARS-CoV-2, Synthetic)
UseTags3xFlag-6HisExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG_Xph20-SNAPf-CCR5TC
Plasmid#135537PurposeEncodes a specific PSD-95 binder (Xph20) fused to SNAPf, CCR5TC zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph20
UseTagsSNAPfExpressionMammalianMutationPromoterCAGAvailable sinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF670
Plasmid#88337PurposeDonor Vector containing ZNF670 transcription factor, part of the Human TFome CollectionDepositorInsertZNF670 (ZNF670 Human)
UseGateway donor vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pATP416-pluxO5-ptetO7-crtYBI
Plasmid#165975PurposeExpresses carotenoid biosynthesis gene in response to homoserine lactone and doxycycline in yeast expressing LuxTA and rtTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyTagsExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pluxO5), Synthetic promoter (…Available sinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only