pLV-Hyg-Snrnp40-CRISPR-resistant
(Plasmid
#134251)
-
PurposeLentivector encoding CRISPR-resistant Snrnp40
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134251 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLV-EF1a -MCS-IRES-Hyg
-
Backbone manufacturerBioSettia
- Backbone size w/o insert (bp) 9200
- Total vector size (bp) 10300
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSnrp40
-
Alt nameWdr57
-
Alt namePrp8bp
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1077
-
Mutationmutated coding sequence “gataactatgcgacgttgaa” to “gaCaaTtaCgcCacCttAaa”
-
GenBank IDNM_025645
-
Entrez GeneSnrnp40 (a.k.a. 0610009C03Rik, Prp8bp, Wdr57)
- Promoter EF1a
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer TTCGGCCAGTAACGTTAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-Hyg-Snrnp40-CRISPR-resistant was a gift from Bruce Beutler (Addgene plasmid # 134251 ; http://n2t.net/addgene:134251 ; RRID:Addgene_134251) -
For your References section:
Syndromic immune disorder caused by a viable hypomorphic allele of spliceosome component Snrnp40. Zhang D, Yue T, Choi JH, Nair-Gill E, Zhong X, Wang KW, Zhan X, Li X, Choi M, Tang M, Quan J, Hildebrand S, Moresco EMY, Beutler B. Nat Immunol. 2019 Oct;20(10):1322-1334. doi: 10.1038/s41590-019-0464-4. Epub 2019 Aug 19. 10.1038/s41590-019-0464-4 PubMed 31427773