-
Plasmid#109131PurposeCation channelrhodopsin CoChR fused to mRuby2 fluorophore and targeted to the neuronal soma and proximal dendritesDepositorInsertCoChR-mRuby2-ST
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-BECN1
Plasmid#99328PurposeComponent for mammalian expression of recombinant PI3KC3-C1 complexDepositorInsertBeclin 1 (BECN1 Human)
UseTagsStrep-Strep-FlagExpressionMammalianMutationPromoterCMVAvailable sinceAug. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF-sh-mBVRA
Plasmid#100286PurposeExpression vector for phycocyanobilin (PCB) synthesis and shRNA for mouse BVRA gene in mammalian cellsDepositorInsertsMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
shRNA for mouse BVRA
UseTagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoter and H1 promoterAvailable sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-S-B.1.617.2-FLAG
Plasmid#177097PurposeB.1.617.2 variant S-protein with c-terminal FLAG tagDepositorInsertS-protein B.1.617.2 (S SARS-CoV-2)
UseTagsFLAGExpressionMammalianMutationPromoterAvailable sinceNov. 2, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAGGS/EG5-RBD
Plasmid#213410PurposeMammalian cell expression of SARS-CoV-2 Spike RBD protein of OMICRON.EG5 variantDepositorInsertpCAGGS/EG5-RBD (S )
UseTags6 His TagExpressionMammalianMutationG339H,R346T,L368I,S371F,S373P,S375F,T376A,D405N,R…PromoterAvailable sinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Chronos-mRuby2-ST
Plasmid#105446PurposeCation channelrhodopsin Chronos fused to mRuby2 fluorophore and targeted to the neuronal soma and proximal dendritesDepositorInsertChronos-mRuby2-ST
UseTagsmRuby2 and soma targeting motifExpressionMutationPromoterpCAGGSAvailable sinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i1 sgRNA / hSpCas9
Plasmid#172825PurposeMammalian expression of a sgRNA targeting the intron 1 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SP-CLSTN2-3xHAtag
Plasmid#191693PurposeFor expression coding sequencing of CLSTN2DepositorInsertsignal peptide, full length coding sequence of CLSTN2 and 3xHAtag
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-AviMta2-3xFiBsd
Plasmid#140964Purposefull-length wt Avi-Mta2-3XFLAG-iBsd cDNA w/CAG promoter and Blasticidin resistance, cloned from mouse ES cellsDepositorInsertmetastasis-associated gene family, member 2 (Mta2 Mouse)
UseTags3xFLAG, Avi, and TEVExpressionMammalianMutationPromoterCAGAvailable sinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-ACTG1
Plasmid#66943PurposeCRISPaint target selector ACTG1DepositorInsertgRNA ACTG1
UseTagsExpressionMutationPromoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2
Plasmid#86610PurposeExpresses the ATP1A1 G2 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 exon 4. Px330-like plasmidDepositorInsertATP1A1 G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainTagsExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
DN1-Gli3 in AINGpCAGGS
Plasmid#121970Purposemedium Gli3 transcriptional activatorDepositorInsertDN2Gli3 (GLI3 Human)
UseChick electroporationTags5xmycExpressionMammalianMutationN terminus deletion (nt1-864)PromoterAvailable sinceApril 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_DRS-1 sgRNA / hSpCas9
Plasmid#172841PurposeMammalian expression of the DRS-1 synthetic sgRNA sequence under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertDRS-1 sgRNA under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promoterAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cav2.2 D122A HA pCAGGS
Plasmid#206097Purposeexpression of rabbit Cav2.2 calcium channel with an exofacial double HA tag in domain II and a D122A mutation that disrupts the interaction with ?2?-1DepositorInsertcacna1b (CACNA1B Rabbit)
UseTagsExpressionMammalianMutationD122APromoterCMV/B-actinAvailable sinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
G1397 DddAtox-C–dSpCas9
Plasmid#157836Purposeexpresses split DddAtox-Cas9 construct in mammalian cellsDepositorInsertbpNLS–G1397 DddAtox-C–dSpCas9–UGI–UGI–bpNLS
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xHAtag-SP-PTPRO
Plasmid#191696PurposeFor expression coding sequencing of PTPRODepositorInsertsignal peptide, 3xHAtag and full length coding sequence of PTPRO
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-dSpCas9
Plasmid#92113PurposeExpression plasmid for human codon-optimized dead/inactive SpCas9 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive SpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, H840APromoterCbhAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCaSpeR-act5cB-GAL4QF
Plasmid#61309PurposeExpresses chimeric transactivator GAL4_DBD:QF2w_AD in DrosophilaDepositorInsertGAL4_DBD::QF2w_AD
UseTagsExpressionInsectMutationChanged EK on C-terminus of QF2 to KKKKPromoterAvailable sinceApril 21, 2015AvailabilityAcademic Institutions and Nonprofits only