Showing: 11501 - 11520 of 16040 results
-
Plasmid#181957PurposeGenetically encoded FRET-based PKA activity reporter fused to AKAP79.DepositorInsertAKAP79-AKAR4 (AKAP5 Human)
UseTagsAKAP79, Cerulean, HIS tag, and cpVenus(E172)ExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
SNAP-ACE2
Plasmid#178592PurposeExpresses SNAP-fused ACE2 protein that can be fluorescently labelled using SNAP substrates.DepositorInsertangiotensin-converting enzyme 2 (ACE2 Human)
UseTagsFlag and SNAPExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pCEP4 TAPBPR-TM-TN6
Plasmid#178650PurposeMammalian expression of FLAG-tagged TAPBPR with MHC TM (E205K, R207E, Q209S, Q272S)DepositorInsertTAPBPR (TAPBPL Human)
UseTagsFLAG and Signal/leader sequence from HLA class I …ExpressionMammalianMutationE205K, R207E, Q209S, Q272S, switched transmembran…PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pET28b-MBP-TEV-PWWP_DNMT3A
Plasmid#186970PurposeBacterial expression of human DNMT3A PWWP domain (residues 278–427) with His-MBP tag and TEV protease cleavage site.DepositorInsertDNMT3A PWWP domain (DNMT3A Human, Synthetic)
UseTagsHis-MBPExpressionBacterialMutationPWWP domain (residues 278–427)PromoterT7AvailabilityAcademic Institutions and Nonprofits only -
FRB-GFP-Gab1(Y628F/Y660F)
Plasmid#188658PurposeFRB coupled to GFP tagged Gab1 with Shp2 binding sites mutated to PheDepositorInsertGRB associated binding protein 1 (Gab1 Mouse)
UseTagsFRB and GFPExpressionMammalianMutationY628F and Y660FPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pWPI-LUC7L2-3xFLAG
Plasmid#201641PurposeOver-expression of 3xFLAG-tagged human LUC7L2DepositorInsertLUC7L2 (LUC7L2 Human)
UseLentiviralTags3xFLAGExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
1BR9-AtWUSSTOP-Δα3
Plasmid#202056PurposeE. coli expression vector for N-ter GFP11 tagged Arabidopsis thaliana WUSCHEL with the third helix in the homeodomain deleted.DepositorInsertAtWUS E. Coli Codon Optimized, third helix of homeodomain deleted (WUS Mustard Weed)
UseTags6xHis and GFP11ExpressionBacterialMutationthird helix of homeodomain deleted (AA82-102)PromoterT7 PromoterAvailabilityAcademic Institutions and Nonprofits only -
opto-E-cad GFP
Plasmid#203327PurposeExpresses E-cadherin with a LOV2 insert after T133 for blue light inhibition in mammalian cellsDepositorInsertPhotoswitchable - E-cadherin with GFP tag (CDH1 Human)
UseTagsGFPExpressionMammalianMutationAddition of Aslov2 domain at T133 of human E-cadh…PromoterAvailabilityAcademic Institutions and Nonprofits only -
pCW-HA-hRb-delta-CDK-T373D-S608D-S612D-puro
Plasmid#212675PurposeExpress tagged hRb phosphosite mutantDepositorInsertRb (RB1 Human)
UseLentiviralTagsHAExpressionMutation15 CDK phospho-sites are mutated to alanines, and…PromoterTREAvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-hWIPI1A-3×FLAG
Plasmid#215509PurposeExpresses FLAG tagged human WIPI1A.DepositorInsertWD-repeat protein interacting with phosphoinositides 1A (WIPI1 Human)
UseRetroviralTags3×FLAGExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pLJM1-B-GRAM-H-NeoR
Plasmid#211709PurposeLentiviral expression of a dimerization-dependent fluorescent protein (ddFP) subunit (B) fused with the GRAM domain of GRAMD1b carrying a G187L mutation (B-GRAM-H)DepositorInsertB-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseLentiviralTagsddFP-B3ExpressionMammalianMutationChanged Glycine 187 to LeucinePromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pLJM1-B-GRAM-W-NeoR
Plasmid#211710PurposeLentiviral expression of a dimerization-dependent fluorescent protein (ddFP) subunit (B) fused with the GRAM domain of GRAMD1b carrying a G187W mutation (B-GRAM-W)DepositorInsertB-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseLentiviralTagsddFP-B3ExpressionMammalianMutationChanged Glycine 187 to TryptophanPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx6
Plasmid#82514PurposeLentivirus vector. Expresses Halotag-Cbx6 fusion proteins in mammalian cells.DepositorInsertChromobox Homolog 6 (CBX6 Human)
UseLentiviralTagsHaloTagExpressionMammalianMutationPromotercmvAvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx7
Plasmid#82515PurposeLentivirus vector. Expresses Halotag-Cbx7 fusion proteins in mammalian cells.DepositorInsertChromobox Homolog 7 (CBX7 Human)
UseLentiviralTagsHaloTagExpressionMammalianMutationPromotercmvAvailabilityAcademic Institutions and Nonprofits only -
pT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
Plasmid#140082PurposeEntry cloning vector for in vitro transcription or expression of SpCas9 sgRNAs from a T7 promoterDepositorInsertpT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
UseIn vitro transcription (mrna synthesis)TagsExpressionBacterialMutationPromoterT7AvailabilityAcademic Institutions and Nonprofits only -
flag-hKLF6 (1006)
Plasmid#49488Purposeexpresses human flag tagged KLF6 in mammalian cellsDepositorInsertKFL6 (KLF6 Human)
UseTagsFlagExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
flag-hKLF6 P149S (1008)
Plasmid#49496Purposeexpresses human Flag tagged KLF6 with P149S mutationDepositorInsertKFL6-P149S (KLF6 Human)
UseTagsFlagExpressionMammalianMutationP149SPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-GJA1-20K-V5
Plasmid#49859PurposeEncodes C-terminal fragment of human connexin 43 initiating at M213, with M281 and M320 mutated to L, and a V5 C-terminal fusion tagDepositorInsertGJA1-20k (GJA1 Human)
UseTagsV5ExpressionMammalianMutationGJA1-20k fragment corresponds to residues 213-382…PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pSLIK-NFLAG-hFUS
Plasmid#50487PurposeProduces lentivirus expressing human FUS with FLAG tag at its N-terminus by co-transfection with psPAX2 and pMD2GDepositorInsertFUS (FUS Human)
UseLentiviralTagsFLAGExpressionMutationPromoterTREAvailabilityAcademic Institutions and Nonprofits only
Showing: 11501 - 11520 of 16040 results