-
Plasmid#167293PurposeLentiviral plKO.1 construct coding for a short-hairpin RNA targeting the human gene DDX58 (coding for RLR sensor RIG-I). Contains a puro resistance cassette.DepositorInsertshRNA hsDDX58 (RIGI Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSEM391 - mosTI unc-119 - Pmex-5 - NNN - tbb-2
Plasmid#182351PurposeGermline expression cloning vector for mosTI(unc-119). Transgene inserted between Pmex-5 and tbb-2 3'UTR. MCS or Golden Gate (BsaI: aaaa - MCS - tgag)DepositorTypeEmpty backboneUseTagsExpressionWormMutationPromoterAvailable sinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-3'UTR
Plasmid#136055PurposeCAPRIN1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCACGTTAGTGTCACAAATT)DepositorInsertCAPRIN1 (CAPRIN1 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 hBAX
Plasmid#129580PurposeCRISPR deletion of human BAXDepositorInsertgRNA vs human BAX (BAX Human)
UseLentiviralTagsExpressionMammalianMutationNonePromoterAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSEM394 - mosTI unc-119 - PUPN - NNN - tbb-2
Plasmid#182352PurposePan-neuronal expression cloning vector for mosTI(unc-119). Transgene inserted between Ultra pan neuronal (UPN) promoter and tbb-2 3'UTR. MCS or Golden Gate (BsaI: aaaa - MCS - tgag)DepositorTypeEmpty backboneUseTagsExpressionWormMutationPromoterAvailable sinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_C
Plasmid#72622PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
UseTagsExpressionMammalianMutationPromoterU6 (gRNA1) and H1 (gRNA2)Available sinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 Intergenic control guide 2
Plasmid#193585PurposesgRNA control; induces CAS9 cutting in an intergenic regionDepositorInsertsgRNA control
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEM390 - mosTI unc-119 - Peft-3 - NNN - tbb-2
Plasmid#182350PurposeUbiquitous expression cloning vector for mosTI(unc-119). Transgene inserted between Peft-3 and tbb-2 3'UTR. MCS or Golden Gate (BsaI: aaaa - MCS - tgag)DepositorTypeEmpty backboneUseTagsExpressionWormMutationPromoterAvailable sinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA2
Plasmid#134634Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA2 (UFM1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
p8103 LentiCRISPR v2 sgNT-2
Plasmid#163313PurposeExpresses Cas9 and a non-targeting control guide RNADepositorInsertsgNT-2
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.1039
Plasmid#105566Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterMSCV-LTRAvailable sinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-STAG2 shRNA 1221
Plasmid#31978DepositorInsertSTAG2 (STAG2 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgTelo-MTSa/BFP/pdCas9-C1
Plasmid#162760PurposeExpressing dCas9 and sgRNA containg MTSa targeting telomeresDepositorInsertdCas9 and sgRNA(SL2-sgTelo-MTSa)
UseTagsExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shSMAD4 #2
Plasmid#83091PurposeLentiviral shRNA vector for inducible knockdown of human SMAD4DepositorInsertshSMAD4 (SMAD4 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgTelo-MTSa/EGFP/pdCas9-C1
Plasmid#162759PurposeExpressing dCas9 and sgRNA containg MTSa targeting telomeresDepositorInsertdCas9 and sgRNA(SL2-sgTelo-MTSa)
UseTagsExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSEM388 - mosTI unc-119 - NNN - mScarlet - tbb-2
Plasmid#182348PurposemScarlet fusion cloning vector for mosTI(unc-119). Transgene inserted upstream of mScarlet and tbb-2 3' UTR. MCS or Golden Gate (BsaI: tgcc - MCS - aaaa)DepositorTypeEmpty backboneUseTagsExpressionWormMutationPromoterAvailable sinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEM387 - mosTI unc-119 - NNN - gfp - nls - tbb-2
Plasmid#182347PurposeGFP transcriptional reporter cloning vector for mosTI(unc-119). Transgene inserted upstream of gfp(2xNLS) and tbb-2 3' UTR. MCS or Golden Gate (BsaI: tgcc - MCS - aaaa)DepositorTypeEmpty backboneUseTagsExpressionWormMutationPromoterAvailable sinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shPRDM14-5
Plasmid#193698PurposeConstitutive lentiviral expression of PRDM14 shRNADepositorInsertPRDM14 (PRDM14 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEM386 - mosTI unc-119 - NNN - gfp - tbb-2
Plasmid#182345PurposeGFP fusion cloning vector for mosTI(unc-119). Transgene inserted upstream of gfp and tbb-2 3' UTR. MCS or Golden Gate (BsaI: tgcc - MCS - aaaa)DepositorTypeEmpty backboneUseTagsExpressionWormMutationPromoterAvailable sinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Arkadia-gRNA1
Plasmid#180374Purposetargeting mouse Arkadia geneDepositorInsertArkadia targeting gRNA (Rnf111 Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterhuman U6Available sinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only