-
Plasmid#200357PurposemScarlet BioPart for AVH neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AVHp | wrmScarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00011327, hlh-34Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH79 - [AWAp | wrmScarlet | tbb-2 UTR]
Plasmid#200353PurposemScarlet BioPart for AWA neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWAp | wrmScarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00006109, str-44Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH63 - [AFDp | wrmScarlet | tbb-2 UTR]
Plasmid#200337PurposemScarlet BioPart for AFD neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AFDp | wrmScarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00001535, gcy-8Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB104
Plasmid#199314PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR
UseTagsExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB96
Plasmid#199316PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR
UseTagsExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB91
Plasmid#199319PurposeCombine with Gal4 to direct ACR1 expressionDepositorInsert15xUAS::delta pes-10::::ACR1::let-858 3'UTR
UseTagsExpressionWormMutationPromoter15xUAS::delta pes-10Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB88
Plasmid#199321PurposeCombine with Gal4 to direct TeNL expressionDepositorInsert15xUAS::delta pes-10::::TeNL::let-858 3'UTR
UseTagsExpressionWormMutationKD for calcium is 250 nM, 1 synthetic intronPromoter15xUAS::delta pes-10Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB109
Plasmid#199322PurposeCombine with Gal4 to direct CaMBI 300 expressionDepositorInsert15xUAS::delta pes-10::::CaMBI::let-858 3'UTR
UseTagsExpressionWormMutationOrange CaMBI with 300 nM KD for calciumPromoter15xUAS:::delta pes-10Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT353
Plasmid#204506PurposeIn vitro transcription of RNA probes for in situ hybridization of CeRep55 lncRNAs in nematode (after linearization with NotI and BglI)DepositorInsertCeRep55 tandem repeats from Y73B3A (C. elegans)
UseOtherTagsExpressionMutationPromoterdouble-T7Available sinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT346
Plasmid#204505Purpose5S rDNA used as a probe for chromosome FISH in nematodeDepositorInsert5S rDNA (C. elegans)
UseOtherTagsExpressionMutationPromoterT7Available sinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT318
Plasmid#204508Purposerpl-21 promoter-driven C04F12.1 construct tagged with 2xHA for MosSCI integration at locus ttTi5605 on Chr II in nematodeDepositorInsertrpl-21p::2xHA::C04F12.1 (C. elegans)
UseTags2xHAExpressionWormMutationPromoterrpl-21 (C. elegans)Available sinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT246
Plasmid#204507Purposecsr-1 construct tagged with 2xFLAG for MosSCI integration at locus ttTi5605 on Chr II in nematodeDepositorInsert2xFLAG::csr-1 (C. elegans) (csr-1 Nematode)
UseTags2xFLAGExpressionWormMutationPromotercsr-1 (C. elegans)Available sinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT334
Plasmid#204516PurposeBacterial expression of COH-3 C-terminal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertC-terminal fragment of coh-3 (C. elegans)
UseTags6xHis, MBPExpressionBacterialMutationPromoterT7lacAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT203
Plasmid#204512PurposeBacterial expression of C04F12.1 with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertC04F12.1 (C. elegans)
UseTags6xHis, MBPExpressionBacterialMutationPromoterT7lacAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT239
Plasmid#204522PurposeIn vitro transcription of Mos1 transposase mRNA with SL1 and poly(A) used for microinjection into nematodeDepositorInsertMos1_transposase::glh-2_3'UTR (glh-2 Nematode)
UseOtherTagsExpressionMutationPromoterT7 (minimum seq.)Available sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT517
Plasmid#204518PurposeBacterial expression of CEC-4 with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertcec-4 (C. elegans)
UseTags6xHis, MBPExpressionBacterialMutationPromoterT7lacAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT186
Plasmid#204513PurposeBacterial expression of CSR-1 PAZ domain with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertPAZ domain of csr-1 (C. elegans) (csr-1 Nematode)
UseTags6xHis, MBPExpressionBacterialMutationPromoterT7lacAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT521
Plasmid#204520PurposeBacterial expression of CEC-5 N-terminal fragment with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertN-terminal fragment of cec-5 (C. elegans)
UseTags6xHis, MBPExpressionBacterialMutationPromoterT7lacAvailable sinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT182
Plasmid#204511PurposeBacterial expression of catalytically defective CSR-1a with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertcsr-1a with D769A mutation (C. elegans) (csr-1 Nematode)
UseTags6xHis, MBPExpressionBacterialMutationD769APromoterT7lacAvailable sinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only