-
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-for2
Plasmid#81209Purposefor targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
UseTagsExpressionMammalianMutationPromoterU6Available sinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK gRNA (BRDN0001146383)
Plasmid#76329Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorInsertGK (GK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK gRNA (BRDN0001148115)
Plasmid#76326Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorInsertGK (GK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK gRNA (BRDN0001145307)
Plasmid#76327Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorInsertGK (GK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK gRNA (BRDN0001146936)
Plasmid#76328Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorInsertGK (GK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA:Asip
Plasmid#60968PurposeExpression vector of rat Asip guide RNADepositorInsertAgouti signaling protein gRNA (Asip Rat)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA:kit-1
Plasmid#60969PurposeExpression vector of rat Kit-1 guide RNADepositorInsertv-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Kit Rat)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA:kit-2-1
Plasmid#60970PurposeExpression vector of rat Kit-2-1 guide RNADepositorInsertv-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Kit Rat)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA:kit-2-2
Plasmid#60971PurposeExpression vector of rat Kit-2-2 guide RNADepositorInsertv-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Kit Rat)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcU6_3 MS2 sgRNA
Plasmid#92394PurposeChick-specific U6 sgRNA expression mini-vector, harbouring chick U6_3 pol III promoter, with tracrRNA scaffold containing stem loops allowing binding of bacteriophage MS2 coat protein MCPDepositorInsertchick U6.3 promoter and gRNA cloning cassette including MS2 stem loops
UseCRISPRTagsExpressionMammalianMutationPromoterchick U6.3Available sinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-GG-acceptor
Plasmid#132777PurposePrime editing in mammalian cellsDepositorInsertExchangeable cassette
UseTagsExpressionMammalianMutationSee manuscriptPromoterU6Available sinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA puro
Plasmid#104990PurposeThis 3rd generation lentiviral plasmid expresses a S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from a U6 promoter and puromycin resistance from an EF-1a promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX-sgRNA-BfuAI-2k
Plasmid#112915PurposeEmpty sgRNA expression plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
Dual-sgRNA_hU6-mU6
Plasmid#154194PurposeLentiviral expression plasmid for two sgRNAs from a hU6 and a mU6 promoter. The cloning site design allows a one-step cloning strategy of both sgRNAs. Expresses a Thy1.1 marker.DepositorTypeEmpty backboneUseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC gRNA Shuttle
Plasmid#47024PurposeEncodes a template from which gRNAs can be made via InFusion cloning. The Medicago truncatula U6.6 promoter drives the gRNA. For use in plants.DepositorInsertgRNA Shuttle
UseCRISPR; Cas9TagsExpressionPlantMutationG to T cloning mutation at position 323PromoterMedicago truncatula U6.6Available sinceSept. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA2
Plasmid#164933PurposeExpresses EGFP sgRNA2 in mammalian cellsDepositorInsertsgRNA2 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralTagsExpressionMutationPromoterEFS promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CDK2 gRNA (BRDN0001147786)
Plasmid#77192Purpose3rd generation lentiviral gRNA plasmid targeting human CDK2DepositorInsertCDK2 (CDK2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK9 gRNA (BRDN0001162576)
Plasmid#77170Purpose3rd generation lentiviral gRNA plasmid targeting human CDK9DepositorInsertCDK9 (CDK9 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only