Showing: 7941 - 7960 of 12975 results
-
Plasmid#90763Purpose3rd generation lentiviral gRNA plasmid targeting human MCM6DepositorInsertMCM6 (Guide Designation E2.2)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
MCM7 E3.2 gRNA
Plasmid#90764Purpose3rd generation lentiviral gRNA plasmid targeting human MCM7DepositorInsertMCM7 (Guide Designation E3.2)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
MCM7 E4.2 gRNA
Plasmid#90765Purpose3rd generation lentiviral gRNA plasmid targeting human MCM7DepositorInsertMCM7 (Guide Designation E4.2)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
MELK E5.2 gRNA
Plasmid#90766Purpose3rd generation lentiviral gRNA plasmid targeting human MELKDepositorInsertMELK (Guide Designation E5.2)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
MELK E6.2 gRNA
Plasmid#90767Purpose3rd generation lentiviral gRNA plasmid targeting human MELKDepositorInsertMELK (Guide Designation E6.2)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
MIS18BP1 F9.1 gRNA
Plasmid#90768Purpose3rd generation lentiviral gRNA plasmid targeting human MIS18BP1DepositorInsertMIS18BP1 (Guide Designation F9.1)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
MIS18BP1 F10.1 gRNA
Plasmid#90769Purpose3rd generation lentiviral gRNA plasmid targeting human MIS18BP1DepositorInsertMIS18BP1 (Guide Designation F10.1)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
MISP H9.2 gRNA
Plasmid#90770Purpose3rd generation lentiviral gRNA plasmid targeting human MISPDepositorInsertMISP (Guide Designation H9.2)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
px330 Rosa26 AscI LH291Gu1 (LH500)
Plasmid#99628PurposePlasmid used to target the pre-modified Rosa26 allele with Cas9DepositorInsertCas9
UseCRISPRTags3xFLAGExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
px330 Rosa26 Gu1 (LH416)
Plasmid#99629PurposePlasmid used to target the wildtype Rosa26 allele with Cas9DepositorInsertCas9
UseCRISPRTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Afp
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorInsertdCas9 and gRNA targeting Afp (Afp Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA1
Plasmid#99734PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorInsertSaCas9 gRNA targeting Yap1 (Yap1 Mouse)
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA2
Plasmid#99735PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorInsertSaCas9 gRNA targeting Yap1 (Yap1 Mouse)
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA3
Plasmid#99736PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorInsertSaCas9 gRNA targeting Yap1 (Yap1 Mouse)
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
PB-UniSAM
Plasmid#99866PurposeEncodes for Cas9-VP64, MS2-p65-HSF1, mCherry and for the gRNA 2.0DepositorInsertUniSAM-mCherry + U6-gRNA2.0
UseCRISPR and Synthetic Biology; Dcas9-sam activationTagsExpressionMammalianMutationBbsI sites in CDS were ablated by consensus mutat…PromoterEF1aAvailabilityAcademic Institutions and Nonprofits only
Showing: 7941 - 7960 of 12975 results