-
Plasmid#114442PurposeEntry vector for gateway cloning containing human PALI1 coding sequenceDepositorInsertPALI1 (LCOR Human)
UseGateway entry cloningTagsExpressionMutationPromoterNoneAvailable sinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pAC1-V16-hGDNF
Plasmid#122035PurposeAAV vector, pTet bidi (bidirectional tetracycline-responsive promoter) driving Tet-dependent rtTA and hGDNF expressionDepositorInserthGDNF (GDNF Human)
UseAAVTagsExpressionMutationPromoterAvailable sinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk13_Nterm_FlagHa
Plasmid#127343PurposeN-terminal Flag- HA- tandem epitope tagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into Gateway entry vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UseEntry vector with transgene for gateway cloningTagsFlag- HA- Tandem EpitopesExpressionMutationBase pairs 1-1554 of transgene are codon optimize…PromoterNoneAvailable sinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTXBI-mClover-YTH domain
Plasmid#177123PurposeBacterial expression of YTH domain of YTHDC1 tagged with N-terminal mClover3 and C-terminal Mxe GtrA intein-Chitin binding domain for protein purificationDepositorInsertYTHDC1 (YTH domain) (YTHDC1 Human)
UseTagsMxe GyrA intein-Chitin binding domain for protein…ExpressionBacterialMutationYTH domain only (IDR1 and IDR2 deletion)PromoterT7Available sinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTXBI-mclover-YTH-IDR2
Plasmid#177122PurposeBacterial expression of YTH-IDR2 fragment of YTHDC1 tagged with N-terminal mClover3 and C-terminal Mxe GtrA intein-Chitin binding domain for protein purificationDepositorInsertYTHDC1 (YTH and IDR2 domains) (YTHDC1 Human)
UseTagsMxe GyrA intein-Chitin binding domain for protein…ExpressionBacterialMutationYTH and IDR2 domains only (IDR1 deletion)PromoterT7Available sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2F04
Plasmid#70901PurposeGateway entry cloneDepositorInsertmod(mdg4) (mod(mdg4) Fly)
UseGateway entry vectorTagsExpressionMutationPromoterAvailable sinceNov. 19, 2015AvailabilityAcademic Institutions and Nonprofits only