We narrowed to 16,389 results for: grna
-
Plasmid#111823PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 349-369
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_314
Plasmid#111822PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 294-314
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJA50
Plasmid#59931PurposegRNA for cleavage at unc-58(e665) locus in C elegansDepositorInsertunc-58(e665) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJA59
Plasmid#59932PurposegRNA for cleavage at unc-109(n499) locus in C elegansDepositorInsertunc-109(n499) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1.linker_KO
Plasmid#164688PurposeFor CRISPR knockout of miR-144~451 linker region by lentiviral delivery of Cas9 and linker gRNADepositorInsertmiR-144~451 linker CRISPR KO gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCUX1.1.0-gDNA
Plasmid#112434PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor CUX1DepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJA14
Plasmid#59929PurposegRNA for cleavage at rde-1(H974) locus in C elegansDepositorInsertrde-1(H974) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB11785
Plasmid#212699PurposegRNA targeting to the intergradtion site E4DepositorInsertgRNA targeting to the intergradtion site E4
ExpressionYeastAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB10769
Plasmid#212694PurposegRNA targeting to the intergradtion site E2DepositorInsertgRNA targeting to the intergradtion site E2
ExpressionYeastAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB12719
Plasmid#212702PurposegRNA targeting to the intergradtion site F3DepositorInsertgRNA targeting to the intergradtion site F3
ExpressionYeastAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB12720
Plasmid#212704PurposegRNA targeting to the gene 4HPPD locusDepositorInsertgRNA targeting to the gene 4HPPD locus
ExpressionYeastAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB11787
Plasmid#212695PurposegRNA targeting to the intergradtion site E2DepositorInsertgRNA targeting to the intergradtion site E2
ExpressionYeastAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB6637
Plasmid#212696PurposegRNA targeting to the intergradtion site E3DepositorInsertgRNA targeting to the intergradtion site E3
ExpressionYeastAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB8860
Plasmid#212697PurposegRNA targeting to the intergradtion site E3DepositorInsertgRNA targeting to the intergradtion site E3
ExpressionYeastAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB8856
Plasmid#212701PurposegRNA targeting to the intergradtion site C3DepositorInsertgRNA targeting to the intergradtion site C3
ExpressionYeastAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB8866
Plasmid#212703PurposegRNA targeting to the intergradtion site F3DepositorInsertgRNA targeting to the intergradtion site F3
ExpressionYeastAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB6630
Plasmid#212700PurposegRNA targeting to the intergradtion site C3DepositorInsertgRNA targeting to the intergradtion site C3
ExpressionYeastAvailable SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB6638
Plasmid#212698PurposegRNA targeting to the intergradtion site E4DepositorInsertgRNA targeting to the intergradtion site E4
ExpressionYeastAvailable SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only