We narrowed to 16,410 results for: grna
-
Plasmid#100894PurposeLentiviral gRNA deliveryDepositorInsertE2Crimson
Available SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gCD44v2)-EF1a-BFP-Puro-Cas9(FZ)
Plasmid#117134PurposeAll-in-one expression vector for Cas9 and gRNA against CD44DepositorInsertgCD44 v2 (Cd44 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, human EF1a promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
Anep8_Cas9
Plasmid#117169PurposeExpressed Cas9 in Aspergillus with LIC tags for easy gRNA cloningDepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Filamentous fungi e…PromoterPkiAvailable SinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJA58
Plasmid#59933PurposegRNA for cleavage at dpy-10(cn64) locus in C elegansDepositorInsertdpy-10(cn64) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJA42
Plasmid#59930PurposegRNA for cleavage at rol-6(su1006) locus in C elegansDepositorInsertrol-6(su1006) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDB4282
Plasmid#98701PurposeA plasmid containing the 3' portion of the ura4 marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-ura4 systemDepositorInsertgRNA PCR template
UseCRISPRExpressionYeastAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDB4283
Plasmid#98702PurposeA plasmid containing the 3' portion of the bsdMX marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-bsdMX systemDepositorInsertgRNA PCR template
UseCRISPRExpressionYeastAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_191
Plasmid#111821PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 171-191
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-ACTG1
Plasmid#66943PurposeCRISPaint target selector ACTG1DepositorInsertgRNA ACTG1
Available SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-HIST1H4C
Plasmid#66944PurposeCRISPaint target selector HIST1H4CDepositorInsertgRNA HIST1H4C
Available SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_369
Plasmid#111823PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 349-369
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_314
Plasmid#111822PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 294-314
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJA50
Plasmid#59931PurposegRNA for cleavage at unc-58(e665) locus in C elegansDepositorInsertunc-58(e665) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJA59
Plasmid#59932PurposegRNA for cleavage at unc-109(n499) locus in C elegansDepositorInsertunc-109(n499) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1.linker_KO
Plasmid#164688PurposeFor CRISPR knockout of miR-144~451 linker region by lentiviral delivery of Cas9 and linker gRNADepositorInsertmiR-144~451 linker CRISPR KO gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCUX1.1.0-gDNA
Plasmid#112434PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor CUX1DepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJA14
Plasmid#59929PurposegRNA for cleavage at rde-1(H974) locus in C elegansDepositorInsertrde-1(H974) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB11785
Plasmid#212699PurposegRNA targeting to the intergradtion site E4DepositorInsertgRNA targeting to the intergradtion site E4
ExpressionYeastAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only