Showing: 661 - 680 of 4040 results
-
Plasmid#92391Purposeproduces AAV expressing Cal-light M13-TevC component and TdTomatoDepositorInsertM13-TEV-C-P2A-TdTomato
UseAAV and Synthetic BiologyTagsTdTomatoExpressionMammalianMutationPromoterhuman synapsinAvailabilityAcademic Institutions and Nonprofits only -
pAAV-TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA
Plasmid#92392Purposeproduces AAV expressing Cal-light TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTADepositorInsertTM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA
UseAAV and Synthetic BiologyTagsExpressionMammalianMutationPromoterHuman SynapsinAvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-mRuby3-WPRE
Plasmid#99279PurposeCan be used to generate AAV virus that will express mRuby3 in the presence of CreDepositorInsertmRuby3
UseAAV and Cre/LoxTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-mScarlet-WPRE
Plasmid#99280PurposeCan be used to generate AAV virus that will express mScarlet in the presence of CreDepositorInsertmScarlet
UseAAV and Cre/LoxTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-dSa-VPR
Plasmid#99651PurposeExpresses tripartite VP64-p65-RTA activator fused to C term. of dead Sa Cas9DepositorInsertdCas9
UseAAVTagsVP64-p65-RTA activatorExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-dSa-VP64-p65(100-261)-RTA(125-190)
Plasmid#99679PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domainsDepositorArticleInsertdCas9
UseAAVTagsVP64-p65(101-261)-RTA(125-190)ExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-dSa-VP64
Plasmid#99680PurposeExpresses dSa Cas9 fused to gold standard VP64 activatorDepositorArticleInsertdCas9
UseAAVTagsVP64ExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa-VPR mini.
Plasmid#99685PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoterDepositorArticleInsertdCas9
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-dSa-VPR mini.
Plasmid#99686PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from EFS promoterDepositorArticleInsertdCas9
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa-VPR mini.-1X snRP1
Plasmid#99687PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains with 17 nt snRP1 poly adenylation signalDepositorArticleInsertdCas9
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa-VPR mini.-2X snRP1
Plasmid#99688PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains with 34 nt dual snRP1 poly adenylation signalDepositorArticleInsertdCas9
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa-VPR mini.-syn pA
Plasmid#99689PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains with syn pA (poly adenylation) signalDepositorArticleInsertdCas9
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Afp
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorInsertdCas9 and gRNA targeting Afp (Afp Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Afp
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorInsertdCas9 and gRNA targeting Afp (Afp Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only
Showing: 661 - 680 of 4040 results