-
Plasmid#227335PurposeDonor template for miRFP670nano3 insertion into the C-terminus of the H3C2 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 (Addgene #207780)DepositorArticleInsertH3C2 Homology Arms flanking a miRFP670nano3 Tag (H3C2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-H2BC11-MMEJ
Plasmid#227333PurposeMMEJ Donor template for mStayGold-2A-Puro insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorArticleInsertH2BC11 Short Homology Arms flanking a mStayGold-2A-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-TUBA1B
Plasmid#227327PurposeDonor template for mStayGold insertion into the N-terminus of the TUBA1B locus. For tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763)DepositorArticleInsertTUBA1B Homology Arms flanking a mStayGold Tag (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-MAPRE1
Plasmid#227324PurposeDonor template for mStayGold insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorArticleInsertMAPRE1 Homology Arms flanking a mStayGold Tag (MAPRE1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-TUBA1B
Plasmid#227321PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the TUBA1B locus. For tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763)DepositorArticleInsertTUBA1B Homology Arms flanking a Puro-2A-mStayGold Cassette (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CEP192
Plasmid#227289PurposeDonor template for mStayGold insertion into the C-terminus of the CEP192 locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PITCh-CEP192 (Addgene #227288)DepositorArticleInsertCEP192 Homology Arms flanking a mStayGold Tag (CEP192 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorArticleInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-a11helixDel-sgEIF3D
Plasmid#222135PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorInserteIF3D (EIF3D Human)
UseLentiviralTagsBFP-P2AExpressionMutationT317E, N320E, H321APromoterAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-CtermDel-sgEIF3D
Plasmid#222125PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorInserteIF3D (EIF3D Human)
UseLentiviralTagsBFP-P2AExpressionMutationF527 truncationPromoterAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-a5helixDel-sgEIF3D
Plasmid#222133PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorInserteIF3D (EIF3D Human)
UseLentiviralTagsBFP-P2AExpressionMutationD249Q, V262I, Y263APromoterAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-S528N-S529N-sgEIF3D
Plasmid#222129PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorInserteIF3D (EIF3D Human)
UseLentiviralTagsBFP-P2AExpressionMutationS528N, S529NPromoterAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
SaCas9v2-Puro
Plasmid#178802PurposeSaCas9 with 2A-Puro, and a cloning backbone for sgRNA.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHExpressionMutationPromoterEF1a and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mScarlet-H3C2
Plasmid#207781PurposeDonor template for mScarlet insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorArticleInsertH3C2 Homology Arms flanking a mScarlet Tag (H3C2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-C-mNeon-Blast-H3C2
Plasmid#207782PurposeDonor template for mNeon-2A-Blast insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorArticleInsertH3C2 Homology Arms flanking a mNeon-Blast Cassette (H3C2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-sTagRFP-TUBA1B
Plasmid#207765PurposeDonor template for sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorArticleInsertTUBA1B Homology Arms flanking a sTagRFP Tag (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Blast-moxGFP-TUBA1B
Plasmid#207766PurposeDonor template for Blast-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorArticleInsertTUBA1B Homology Arms flanking a Blast-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-moxGFP-TUBA1B
Plasmid#207767PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorArticleInsertTUBA1B Homology Arms flanking a Puro-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-sTagRFP-TUBA1B
Plasmid#207769PurposeDonor template for Puro-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorArticleInsertTUBA1B Homology Arms flanking a Puro-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits