We narrowed to 15,775 results for: grna
-
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCgsgRNA_crtYf
Plasmid#153338PurposeDouble-plasmid-based CRISPR-Cas9 system in Corynebacterium glutamicum; rep oriVC. glutamicum; pMB1 oriVE. Coli; Pj23119-crRNA targeting crtYf; SpcrDepositorInsertcrRNA targeting crtYf
UseCRISPRExpressionBacterialAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRDA_221
Plasmid#169142PurposeConstitutive expression of EGFP and sgRNAs targeted to EGFP for measurement of activity of AsCas12a\EnAsCas12a.DepositorInsertEGFP , EGFP sgRNA
UseCRISPR and LentiviralAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
PXL
Plasmid#75349PurposePX330 derived. Bbs1 & annealed oligos to insert guide strand. BstB1+Pac1 of PXL and FUX-/pRubiX- T2A-Cas9 for choice of sgRNA, viral backbone, and fluorescent protein. Pac1 to introduce 2nd sgRNA.DepositorInsertCas9
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-sh-hSC
Plasmid#46896Purposeexpression of scrambled shRNADepositorInsertscrambled
UseLentiviral and RNAiExpressionMammalianAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
TRMPV-Neo
Plasmid#27990PurposeRetroviral transfer plasmid for Tet-regulated shRNA expression with a minimal CMV promoter. Contains DsRed2 and Venus fluorescent reporters.DepositorInsertTRMPV-Neo (shRen)
UseRNAi and Retroviral; Fluorescent reportersExpressionMammalianAvailable SinceApril 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
shHIF2α(#2) (HIF2α-#2-pSUPER-retro-GFP/Neo)
Plasmid#22131DepositorInsertsynthethic oligonucleotide
UseRNAi and RetroviralExpressionMammalianMutationsynthethic oligonucleotide encoding shRNA targeti…Available SinceOct. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLKO mouse shRNA 2 raptor
Plasmid#21340DepositorAvailable SinceJuly 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.PKD1.RNAi
Plasmid#10815DepositorAvailable SinceDec. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
pBBK23 pCAS-Tyr-[gRNA: 6=ARS416] (SplitHygR, AmpR)
Plasmid#179007PurposeSp.Cas9 and gRNA yeast expression vector with ARS416 gRNA pre-cloned. Selection =SplitHygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK22 pCAS-Tyr-[gRNA: 5=ARS308] (SplitHygR, AmpR)
Plasmid#179006PurposeSp.Cas9 and gRNA yeast expression vector with ARS308 gRNA pre-cloned. Selection =SplitHygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK17 pCAS-Tyr-[gRNA: 7=HIS3] (SplitKanR, AmpR)
Plasmid#179001PurposeSp.Cas9 and gRNA yeast expression vector with HIS3 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK16 pCAS-Tyr-[gRNA: 6=ARS416] (SplitKanR, AmpR)
Plasmid#179000PurposeSp.Cas9 and gRNA yeast expression vector with ARS416 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK15 pCAS-Tyr-[gRNA: 5=ARS308] (SplitKanR, AmpR)
Plasmid#178999PurposeSp.Cas9 and gRNA yeast expression vector with ARS308 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK14 pCAS-Tyr-[gRNA: 4=XII-5] (SplitKanR, AmpR)
Plasmid#178998PurposeSp.Cas9 and gRNA yeast expression vector withXII-5 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK13 pCAS-Tyr-[gRNA: 3=XII-2] (SplitKanR, AmpR)
Plasmid#178997PurposeSp.Cas9 and gRNA yeast expression vector with XII-2 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrnb4-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128345PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrnb3-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128344PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna6-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128341PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only