We narrowed to 15,981 results for: grna
-
Plasmid#173672PurposeTo clone and express a gRNA in AnophelesDepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pX459_gRNA-AAVS1_hspCas9
Plasmid#193309PurposeCas9 from S. pyogenes and U6 AAVS1 sgRNA (V2.0)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9 from S. pyogenes and U6 AAVS1 sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiGuide-Puro/CD73-gRNA4
Plasmid#132588PurposeLentiviral gRNA vector targeting human CD73DepositorInsertCD73 (NT5E Human)
ExpressionMammalianAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
LCV2_LacZ_sgRNA_2
Plasmid#155093Purposelentiviral plasmid expressing Cas9 and gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR8-PspCas13b_gRNA[ccdbCam]_1xMS2b
Plasmid#196847Purposebackbone for gRNA cloning of dpspCas13b tagged by 1xMS2DepositorTypeEmpty backboneUseCRISPRAvailable sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
gzk328-dpspCas13b_gRNA[ccdbCam]-10xPBSc_Loop
Plasmid#196844Purposebackbone for gRNA cloning of dpspCas13b tagged by 10xPBSc_LoopDepositorTypeEmpty backboneUseCRISPRAvailable sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKL038 Lenti U6 dCas12a gRNA Puro mCherry
Plasmid#195546PurposedCas12a gRNA expression backboneDepositorInsertLenti U6- empty cassette_Direct repeat_puro_mcherry
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Px458-Cas9n-Trp63-Exon4-1sgRNA
Plasmid#88848PurposeCRISPR KO of Trp63DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTrp63 (Trp63 Mouse)
UseCRISPRExpressionMammalianAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0526-sgRNA500
Plasmid#149641Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, parental for gRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaB, PpQE30, P0526Available sinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA_zebrafish_mmp21
Plasmid#72890Purposeplasmid to generate guideRNA against mmp21 gene in zebrafishDepositorAvailable sinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MP-84-spCas9-U6-gRNA-tlock
Plasmid#206936PurposeExpression of spCas9 endonuclease and gRNA in an AAV vector allowing packaging of viral genome smaller than 5 kb.DepositorInsertspCas9
UseAAVTagsSV40 NLSExpressionMammalianPromoterMP-84Available sinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
px335 Mettl14 sgRNA #1
Plasmid#61515Purposeencodes sgRNA sequence for targeting mouse Mettl14 locus (Cas9-Nickase strategy)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgcggcagctcctagctcagc
UseCRISPRExpressionMammalianAvailable sinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
p163_LTJ_sgRNACD90.1
Plasmid#82677PurposesgRNA targeting murine CD90.1. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting mouse CD90.1
UseCRISPRExpressionMammalianPromoterU6Available sinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEHE51
Plasmid#250522PurposeVector for sgRNA expression in Acinetobacter baumannii (CRISPRi). Modified version of pYDE007 (Plasmid #194152) made Golden Gate compatible (BsaI) for sgRNA oligo insertion.DepositorInsertTwo BsaI sites (T-BsaI-BfuI-BsaI-A) inserted between the J23119 promoter and dCas9 handle/gRNA scaffold
ExpressionBacterialPromoterJ23119Available sinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
(326) pAAV SV40-ZsGreen U6-gRNA
Plasmid#163020PurposeFluorescent reporter for Sa gRNA (Bsa1 sites)DepositorInsertZs Green
UseAAVExpressionMammalianPromoterSV40Available sinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKLV2-U6gRNA5(SOX2_v32_7-4)-PGKpuroBFP-W
Plasmid#211986PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-5)-PGKpuroBFP-W
Plasmid#211987PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2AmCherry-W
Plasmid#163179PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only