-
Plasmid#110373PurposeMammalian expression of mKO2-HuR (DelHNS) with FLAG tag, Flp-In T-Rex systemDepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseTagsFLAG and mKO2ExpressionMammalianMutationHNS (HuR nuclear-cytoplasmic shuttling sequence) …PromoterCMVAvailable sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSP1594_2x_NLS
Plasmid#110625PurposeMammalian expression vector for Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9)DepositorInsertsSt1Cas9 LMD-9
None
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianMutationPromoterCAGAvailable sinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
p068 pCS mTRPS1 (M)
Plasmid#11040DepositorInsertTRPS1 mut (Trps1 Mouse)
UseXenopus, mammalian, avian, and zebrafishTagsExpressionMutationTwo Cys residues at positions 917 and 920 in the …PromoterAvailable sinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
p139 pETF-GST RanBP10 L301I
Plasmid#11092DepositorInsertRanBP10 (Ranbp10 Mouse)
UseTagsGSTExpressionBacterialMutationL301I; see depositor comments belowPromoterAvailable sinceDec. 16, 2005AvailabilityAcademic Institutions and Nonprofits only -
Human USP30 (64-502, construct 13i, C77A, MG-31-28)
Plasmid#110747PurposeBacterial expression of human USP30 (construct 13i)DepositorInsertUSP30 (USP30 Human)
UseTagsN-His6-GST-3CExpressionBacterialMutationC77A, F348D, M350S, I353E + insertion deletion: 6…PromoterT7Available sinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-PTEN-deltaPDZ
Plasmid#110182PurposeExpression of a mutated PTEN lacking its 4 last aa, and tagged with EGFPDepositorInsertPTEN (Pten Rat)
UseTagsEGFPExpressionMammalianMutationDeletion of last 4 amino acidsPromoterCMVAvailable sinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS rat IRS-1
Plasmid#11027DepositorInsertIRS-1 (Irs1 Rat)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
BSP179
Plasmid#110915PurposeFor cloning expression cassettes by HR in yeast, Universal MosSCI compatibleDepositorTypeEmpty backboneUseSynthetic Biology; Yeast homologous recombination…TagsExpressionWormMutationPromoterAvailable sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBTK205
Plasmid#110587PurposeBTK Type 3 coding sequence for golden gate assemblyDepositorInsertGFP optim-1
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceFeb. 20, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBTK305
Plasmid#110594PurposeBTK Type 4 terminator for golden gate assemblyDepositorInsertT7 terminator
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceFeb. 20, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
B. thetaiotaomicron mRNA toehold switch sensor
Plasmid#110707PurposeToehold switch sensor to detect a species specific mRNA with GFP outputDepositorInsertB. thetaiotaomicron species specific toehold switch sensor
UseSynthetic BiologyTagsExpressionMutationPromoterT7Available sinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
piHGpd/p82
Plasmid#1105DepositorInsertHSP82 (HSP82 Budding Yeast)
UseTagsExpressionYeastMutationwild-type HSP82 regulated by the strong constitut…PromoterAvailable sinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pHDR-CDKN2A-Ex2-CMV-H2B-mOrange2
Plasmid#110735PurposeRecombination template for replacing CDKN2A Exon2 with Ef1alpha-H2B-mOrange2DepositorInsertH2B-mOrange2
UseOtherTagsExpressionMutationPromoterAvailable sinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTKan-p35S::Csy4-pNOS::cogGFP (C132, JBEI-15898)
Plasmid#110145PurposeTransformation and expression of Csy4 and cogGFP proteins in plantsDepositorInsertCsy4 (ATCS Mustard Weed)
UseTagscogGFPExpressionBacterial and PlantMutationPromoterAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRERRA-PGK-Puro
Plasmid#110859PurposeLentiviral vector for constitutive expression of Cas9-VRERRA in mammalian cells (codon optimized)DepositorInsertCas9-VRERRA
UseLentiviralTagsFLAGExpressionMutationD1135V, G1218R, R1335E, T1337R, and NLS sequence …PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO/Flag-tGFP-Cryz
Plasmid#110378PurposeMammalian expression of turboGFP-CRYZ with FLAG tag, Flp-In T-Rex systemDepositorInsertcrystallin zeta (CRYZ Human)
UseTagsFLAG and tGFPExpressionMammalianMutationPromoterCMVAvailable sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#230
Plasmid#110925PurposeVector for expressing proteins in a subset of 9 DA/ DB cholingergic motor neurons in the C. elegans ventral nerve cordDepositorInsertsunc-129 promoter
unc-54 3' control region
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNIC-ZB-SPRTN-Y117C-FL
Plasmid#110219PurposeExpression in E. coli of full-length SPRTN protein carrying Y112A mutation, a catalytically impaired mutant, with His and ZB tags at N-terminus.DepositorInsertSPRTN (SPRTN Human)
UseTagsHis6 and ZBExpressionBacterialMutationY117C, P296L (see depositor comments below)PromoterAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
RON2-COMP-blac-flag-his
Plasmid#110962PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertrhoptry neck protein 2 (RON2) (PF3D7_1452000 Synthetic)
UseTagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable sinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only