We narrowed to 6,836 results for: mCherry
-
Plasmid#165158PurposeExpresses an ACTB gene fragment with P2A, flanked by mCherry and EGFP, in Mammalian cellsDepositorInsertmCherry-ACTB-P2A-EGFP (ACTB Human)
UseRetroviralTagsEGFP and mCherryExpressionMammalianPromoterCMVAvailable SinceApril 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKG123
Plasmid#63074PurposeRetroviral expression of mCherry-TEV-S-tag CENP-C for protein localization and affinity purification (LAP)DepositorAvailable SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUltra-hot-H2B-mTagBFP2
Plasmid#161792Purpose3rd generation lentiviral multicistronic vector for mammalian expression of mCherry, H2B-mTagBFP2, and one gene of interestDepositorInsertH2B-mTagBFP2
UseLentiviral; MulticistronicTagsmCherry and mTagBFP2ExpressionMammalianMutationI174A in the mTagBFP2 protein according to PLoS O…PromoterUbCAvailable SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Clim Act MCH (CAM)
Plasmid#104443PurposeExpresses mCherry under endogenous actin promoter. It can be used to transfect Corallochytrium limacisporum (Corallochytrea) cells and visualize them by fluorescent microscope.DepositorInsertmCherry
UseExpression in corallochytrium (single-celled euka…PromoteractinAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
Clim EF1 MCH (CEM)
Plasmid#104444PurposeExpresses mCherry under elongation factor 1 promoter. It can be used to transfect Corallochytrium limacisporum (Corallochytrea) cells and visualize them by fluorescent microscope.DepositorInsertmCherry
UseExpression in corallochytrium (single-celled euka…PromoterEF1Available SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
Clim Tub MCH (CTM)
Plasmid#104445PurposeExpresses mCherry under tubulin promoter. It can be used to transfect Corallochytrium limacisporum (Corallochytrea) cells and visualize them by fluorescent microscope.DepositorInsertmCherry
UseExpression in corallochytrium (single-celled euka…Promotertubulin promoterAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC43
Plasmid#66565PurposesgRNA + 2XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherryDepositorInsertssgRNA + 2XPP7
PCP-VP64 IRES mCherry
ExpressionMammalianPromoterCMV and U6Available SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-2E2-HA-mCh
Plasmid#129596PurposeThe encoded protein is the anti-HA frankenbody variant fused with the mCherry. It can be used to track mature and nascent HA tagged proteins in living organism.DepositorInsertAnti-HA frankenbody variant-mCherry (2E2-HA scFv-mCherry)
ExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19/mChe-PM
Plasmid#183168PurposeConstruct for transient expression of plasma membrane-targeted mCherry in plants.DepositorInsertmCherry-PM
TagsOsRac3, O. sativa rac-like GTP-binding protein 3ExpressionPlantAvailable SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM162
Plasmid#173221PurposeExpresses ScFV-GCN4-GFP10M2-GB1-T2A-OptGFP(1-9)-GB1 and Puro-T2A-MCP-mCherry-GFP11-GB1DepositorInsertsScFV-GCN4-GFP10M2-GB1-T2A-OptGFP (1-10)-GB1
MCP-mCherry-GFP11-GB1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromoterCMVAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19/ER-mChe
Plasmid#183163PurposeConstruct for transient expression of endoplasmic reticulum-targeted mCherry in plants.DepositorInsertER-mCherry
Tags25 aa ER signal of Glycine soja kunitz-type tryps…ExpressionPlantAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19/NLS-mChe
Plasmid#183162PurposeConstruct for transient expression of cell nucleus-targeted mCherry in plants.DepositorInsertNLS-mCherry
Tags16 aa nuclear localization signal and 16 aa nucl…ExpressionPlantAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCh-LgBiT-2A-EGFP-Vin-PILATeS
Plasmid#216761PurposePiggyBac vector for stable co-expression of mCherry-LgBiT and EGFP-Vinculin-PILATeS (700 pM) in mammalian cells. Requires transposaseDepositorInsertmCherry-LgBiT-P2A-T2A-EGFP-Vin-PILATeS
TagsEGFP and mCherryExpressionMammalianAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEND-304_Cacnes_tetR
Plasmid#225619PurposeC. acnes with tetR-based inducible expression of mCherry. pBRESP36A with P(PPA_RS09745)+RBS_2+TetR // P(BBa_23119-TetO1O3)+RBS_1+mCherryDepositorInsertTetR
UseSynthetic BiologyTags6xHis and mCherry-V5-6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEND-375_Cacnes_phlF
Plasmid#225620PurposeC. acnes with PhlF-based inducible expression of mCherry. pBRESP36A with P(PPA_RS09745)+RBS_2+PhlF // P(BBa_23119-PhlO1O3)+RBS_1+mCherry.DepositorInsertPhlF
UseSynthetic BiologyTags6xHis and mCherry-V5-6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJZC42
Plasmid#66564PurposesgRNA + 1XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherryDepositorInsertssgRNA + 1XPP7
PCP-VP64 IRES mCherry
ExpressionMammalianPromoterCMV and U6Available SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shNCLX-2
Plasmid#181871PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shNCLX-1
Plasmid#181870PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only