Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Desmoplakin II donor only control (FL-based tension sensor)
(Plasmid #118723)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118723 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLPCX
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6265
  • Total vector size (bp) 14708
  • Modifications to backbone
    modified multiple cloning site
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    human Desmoplakin II-[YPet(short)-FL-mCherry(Y72L)] (internal-1353)
  • Alt name
    Desmoplakin II donor only control for FL-based tension sensor
  • Alt name
    DPII-int (YFLdC)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    8481
  • Mutation
    inserted FL-based tension sensor module after aa1353: Y72L in mCherry mutation to disrupt chromophore formation
  • GenBank ID
    NM_001008844.1
  • Entrez Gene
    DSP (a.k.a. DCWHKTA, DP)
  • Promoter CMV
  • Tag / Fusion Protein
    • YPet(short)-FL-mCherry(Y72L)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGCTcGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Desmoplakin II donor only control (FL-based tension sensor) was a gift from Carsten Grashoff (Addgene plasmid # 118723 ; http://n2t.net/addgene:118723 ; RRID:Addgene_118723)
  • For your References section:

    Mechanical loading of desmosomes depends on the magnitude and orientation of external stress. Price AJ, Cost AL, Ungewiss H, Waschke J, Dunn AR, Grashoff C. Nat Commun. 2018 Dec 11;9(1):5284. doi: 10.1038/s41467-018-07523-0. 10.1038/s41467-018-07523-0 PubMed 30538252