-
Plasmid#168494PurposeMammalian expression of the K8,9A mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.DepositorInsertK8,9A mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (E12,14K)-mVenus
Plasmid#168488PurposeMammalian expression of the E12,14K mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe E12,14K mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K8,9E)-mVenus
Plasmid#168487PurposeMammalian expression of the E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K22,24A)-mVenus
Plasmid#168484PurposeMammalian expression of the K22,24A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K22,24A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K8,9A)-mVenus
Plasmid#168483PurposeMammalian expression of the K8,9A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K8,9A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (G2A)-mVenus
Plasmid#168482PurposeMammalian expression of the G2A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe G2A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-CVm-Sec22b
Plasmid#168029PurposeExpresses eCFP-Sec22b(A131-H190)-mVenus in bacterial cellsDepositorInserteCFP-Sec22b(A131-H190)-mVenus
UseTagsHisx6 and mycExpressionBacterialMutationPromoterAvailable sinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-CVm-VAMP8
Plasmid#168028PurposeExpresses eCFP-VAMP8(G7-R67)-mVenus in bacterial cellsDepositorInserteCFP-VAMP8(G7-R67)-mVenus
UseTagsHisx6 and mycExpressionBacterialMutationPromoterAvailable sinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
KG#901
Plasmid#110936PurposeExpresses Emerald-RAB-3 in the cholinergic motor neuron DA9 for imaging synaptic vesicles in a single neuron in a living animalDepositorInsertsmig-13 promoter
Emerald-RAB-3
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
KG#920
Plasmid#110937PurposeExpresses INS-22-Emerald in the cholinergic motor neuron DA9 for imaging Dense Core Vesicles in a single neuron in a living animalDepositorInsertsmig-13 promoter
INS-22-Emerald
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMin-DHS-4D-GFP
Plasmid#159653PurposeReporter plasmid for the DHS-4D Otx2 enhancer element.DepositorInsertDHS-4D
UseTagsExpressionMammalianMutationPromoterTATAAvailable sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-mSNX27-H112A RNAi-resistant
Plasmid#163621Purposemouse SNX27 cDNA with point mutation to resist siRNA against SNX27 and with a point mutation H112A C-terminally tagged with GFPDepositorInsertmouse SNX27-H112A RNAi-resistant (Snx27 Mouse)
UseTagsGFPExpressionMammalianMutationH112A and RNAi resistancePromoterAvailable sinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shSpc25
Plasmid#160960PurposeSpc25 shRNA in pMKO.1 retroviral vectorDepositorInsertSpc25 shRNA (Spc25 Mouse)
UseRNAi and RetroviralTagsExpressionMutationPromoterU6Available sinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHA841 - hrp-1p::hrp-1HsLCWT
Plasmid#139198PurposeExpresses hrp-1p::hrp-1HsLCWT::hrp-1 3'UTRDepositorInserthrp-1 (hrp-1 Nematode)
UseTagsExpressionWormMutationlast exon replaced with correspoding human sequen…PromoterAvailable sinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHA842 - hrp-1p::hrp-1HsLCD290V
Plasmid#139199PurposeExpresses hrp-1p::hrp-1HsLCD290V::hrp-1 3'UTRDepositorInserthrp-1 (hrp-1 Nematode)
UseTagsExpressionWormMutationD290V, last exon replaced with correspoding human…PromoterAvailable sinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHA845 - hrp-1p::hrp-1HsLCWTmScarlet
Plasmid#139205PurposeExpresses mScarlet tagged hrp-1HsLCWTDepositorInserthrp-1 (hrp-1 Nematode)
UseTagsExpressionWormMutationmScarlet added between RRMs and LC, last exon rep…PromoterAvailable sinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHA846 - hrp-1p::hrp-1HsLCD290VmScarlet
Plasmid#139206PurposeExpresses mScarlet tagged hrp-1HsLCD290VDepositorInserthrp-1 (hrp-1 Nematode)
UseTagsExpressionWormMutationmScarlet added between RRMs and LC, D290V, last e…PromoterAvailable sinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
hnRNPF_PLD
Plasmid#139113Purposeexpress prion like domain of hnRNPFDepositorInserthnRNPF (HNRNPF Human)
UseTagsExpressionBacterialMutation365-415PromoterAvailable sinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfPV-1.8k-Venus-WPRE
Plasmid#156398PurposeExpresses Venus under PV gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralTagsExpressionMutationPromoterAvailable sinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfSP-0.8k-Venus-WPRE
Plasmid#156397PurposeExpresses Venus under SP gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralTagsExpressionMutationPromoterAvailable sinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfSP-1.7k-Venus-WPRE
Plasmid#156396PurposeExpresses Venus under SP gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralTagsExpressionMutationPromoterAvailable sinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfSERT-0.5k-Venus-WPRE
Plasmid#156395PurposeExpresses Venus under SERT gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralTagsExpressionMutationPromoterAvailable sinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfvAChT-1.1k-Venus-WPRE
Plasmid#156390PurposeExpresses Venus under vAChT gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralTagsExpressionMutationPromoterAvailable sinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfCCK-3.9k-Venus-WPRE
Plasmid#156391PurposeExpresses Venus under CCK gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralTagsExpressionMutationPromoterAvailable sinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Antares-SEPLuc IRESv24
Plasmid#141087Purposeprecursor of the bioluminescent reporter pHluc, for detecting extracellular pH changes in tumor acidosis; utilizes weaker mutant of IRESDepositorInsertAntares-T2A-puromycin-IRESv24-SEPLuc
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceMay 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CMV-LMO2 (GLuc-VChR1-EYFP)
Plasmid#72889Purposefusion protein of Gaussia luciferase, Volvox channelrhodopsin-1, and enhanced yellow fluorescent protein for bioluminescent optogeneticsDepositorInsertsGaussia luciferase
Volvox channelrhodopsin 1
Enhanced Yellow Fluorescent Protein
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-control-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128347PurposepAAV encoding control gRNA for CRISPR gRNAs listed aboveDepositorInsertcontrol (negative)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgGAL4
Plasmid#121514PurposesgGAL4 control. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgGAL4
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Geph UTR3m shRNA
Plasmid#121071PurposeNegative control shRNA for plasmid 121070: shRNA targeting the 3'-untranslated region (UTR) of the gephyrin mRNADepositorInsertGPHN shRNA (Gphn Rat)
UseRNAiTagsExpressionMutationPromoterAvailable sinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-Sema4A RNAiR
Plasmid#115172Purposeexpresses RNAi-resistant Sema4A with N-terminal myc tagDepositorInsertSema4A (Sema4a Mouse)
UseTagsmycExpressionMammalianMutationSilent mutation between amino acids in ORF (401-4…PromoterCMVAvailable sinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
miR-223-RFP pCDNA
Plasmid#97142Purposeexpression of miR-223 and TagRFPDepositorInsertmiR-223
UseTagsTagRFPExpressionMammalianMutationPromoterAvailable sinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSI-check2-TAB2-3'UTR
Plasmid#97157PurposeFor dual luciferase report assayDepositorInsertTAB2 3'UTR (TAB2 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
MDH1-PGK-FLAG-TAT-86-D
Plasmid#35976DepositorInserttransactivating protein (tat Human Immunodeficiency Virus)
UseRNAi and RetroviralTagsFlagExpressionMammalianMutationFrom the "D" HIV cladePromoterAvailable sinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
MDH1-PGK-FLAG-TAT-86-C
Plasmid#35982DepositorInserttransactivating protein (tat Human Immunodeficiency Virus)
UseRNAi and RetroviralTagsFlagExpressionMammalianMutationFrom the "C" HIV cladePromoterAvailable sinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pISH-Emx1-SR
Plasmid#105214Purposeto generate a riboprobe for in situ hybridazationDepositorInsertEmx1 (Emx1 Mouse)
UseTo ganerate riboprobeTagsExpressionMutationPromoterAvailable sinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
FLAG-mPar6a K19A
Plasmid#86149PurposeFLAG-mPar6a K19A - Does not bind to aPKCDepositorInsertPar6 (Pard6a Mouse)
UseRetroviralTagsFLAGExpressionMammalianMutationLysine to Alanine mutation K19APromoterLTRAvailable sinceMarch 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGWB425
Plasmid#74819PurposeGateway cloning compatible binary vector for C-terminal fusion with T7 (no promoter).DepositorTypeEmpty backboneUseTagsExpressionPlantMutationPromoterAvailable sinceJuly 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tg 2 kb Violet opsin GFP
Plasmid#72921Purposeviolet opsin promoter from zebra finch (Taeniopygia guttata) gDNA (nucleotides21,946 to 145, corresponding to chr1A_ran-dom:206453–208444 in taeGut1) driving GFPDepositorInsertviolet opsin promoter
UseTagsExpressionMutationPromoterAvailable sinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tg 2 kb Violet opsin DsRed
Plasmid#72920Purposeviolet opsin promoter from zebra finch (Taeniopygia guttata) gDNA (nucleotides21,946 to 145, corresponding to chr1A_ran-dom:206453–208444 in taeGut1) driving DsRedDepositorInsertviolet opsin promoter
UseTagsExpressionMutationPromoterAvailable sinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ac 1.8kb red opsin GFP.
Plasmid#72915Purposered opsin promoter from Carolina anole lizard (Anolis carolinensis) gDNA (nucleotides21,797 to 187, corresponding to chr2:88663108–88664997 in anoCar2.0) driving GFPDepositorInsertred opsin promoter
UseTagsExpressionMutationPromoterAvailable sinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ac 1.8kb red opsin DsRed
Plasmid#72914Purposered opsin promoter from Carolina anole lizard (Anolis carolinensis) gDNA (nucleotides21,797 to 187, corresponding to chr2:88663108–88664997 in anoCar2.0) driving DsRedDepositorInsertred opsin promoter
UseTagsExpressionMutationPromoterAvailable sinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Gg 1.8kb rhodopsin GFP
Plasmid#72917PurposeRhodopsin promoter from chicken (Gallus gallus) gDNA chr12:19,499,638–19,501,514 in galGal4 driving GFPDepositorInsertchicken rhodopsin (RHO Chicken)
UseTagsExpressionMutationPromoterAvailable sinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
Gg 1.8kb rhodopsin DsRed
Plasmid#72916PurposeRhodopsin promoter from chicken (Gallus gallus) gDNA chr12:19,499,638–19,501,514 in galGal4 driving DsRedDepositorInsertchicken rhodopsin (RHO Chicken)
UseTagsExpressionMutationPromoterrhodopsinAvailable sinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO
Plasmid#68356Purpose-The prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianMutationPromoterSynthetic Probasin ARRx2 and U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Sema4b-ISH-2kb
Plasmid#68030PurposeContains 2kb cDNA fragment for probe synthesis for mRNA in situ hybridization, species: mouseDepositorInsertSemaphorin-4B (Sema4b Mouse)
UseMrna in situ hybridization probeTagsExpressionMutationPromoterAvailable sinceAug. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Sema4f-ISH-2kb
Plasmid#68033PurposeContains 2kb cDNA fragment for probe synthesis for mRNA in situ hybridization, species: mouseDepositorInsertSemaphorin-4F (Sema4f Mouse)
UseMrna in situ hybridization probeTagsExpressionMutationPromoterAvailable sinceAug. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc'-cYAP-1
Plasmid#66854PurposeExpress Myc-tagged C.elegans YAP-1 in mammalian cellsDepositorInsertYAP-1 (yap-1 Nematode)
UseTagsMycExpressionMammalianMutationPromoterCMVAvailable sinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc'-EGL-44
Plasmid#66855PurposeExpress Myc-tagged C.elegans EGL-44 in mammalian cellsDepositorInsertEGL-44 (CELE_F28B12.2 Nematode)
UseTagsMycExpressionMammalianMutationPromoterCMVAvailable sinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pClneoEGFPC-let60 K16N
Plasmid#66861PurposeExpress GFP-tagged dominat negative let60, in which Lysine 16 is mutated to asparagine, in mammalian cellsDepositorInsertLet-60 (let-60 Nematode)
UseTagsGFPExpressionMammalianMutationLysine 16 is mutated to asparaginePromoterCMVAvailable sinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only