We narrowed to 9,850 results for: CAG
-
Plasmid#92310PurposeCRISPR-GFP-gRNA for cutting VEcadDepositorAvailable sinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pLH-stsgRNA1.1
Plasmid#64116PurposeVector for expression of St1 sgRNA1.1 in mammalian cellsDepositorInsertSt1 sgRNA1.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (RAB7A)
Plasmid#170118PurposeAAV vector carrying a guide RNA targeting the human RAB7A mRNADepositorAvailable sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFL-mPML-2CAMut-iB
Plasmid#140286PurposeExpression of mouse PML Ca mutantDepositorAvailable sinceMay 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
human a5 full length
Plasmid#217818PurposeFull length human integrin a5 expressionDepositorAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
shYES1 # 1
Plasmid#42546DepositorAvailable sinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
mouse a2b full length
Plasmid#217812PurposeFull length mouse integrin a2b expressionDepositorAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRA03
Plasmid#103141PurposeTriple gRNA expression separated with 28nt Csy4 motifDepositorInsertgRNAs
ExpressionYeastAvailable sinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
CRY2clust-mCherry-RANK-P2A-CIBNcaax
Plasmid#208613PurposeMammalian expression of CRY2clust-mCherry-RANK-P2A-CIBNcaax (Opto-RANKm)DepositorInsertCRY2clust-mCherry-RANK-P2A-CIBNcaax (Cry2 Mustard Weed, Mouse)
TagsCAAX and mCherryExpressionMammalianPromoterCAGAvailable sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmStayGold_I3
Plasmid#239336PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with mStayGold in mammalian cells. Assembles into nanocages tagged with 60 FPs.DepositorInsertI3-01
TagsmStayGoldExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shTREX1
Plasmid#127700PurposeDoxycyclin inducible shRNA knockdown of both human and mouse TREX1 geneDepositorAvailable sinceFeb. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shLuc
Plasmid#136587PurposeExpresses an inducible short hairpin targeting firefly luciferase sequenceDepositorInsertshLuc
UseLentiviralExpressionMammalianAvailable sinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Circular 200,100 (mPCSK9)
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-irf3-shrna5
Plasmid#127649PurposeKnock-down of human IRF3DepositorInsertIRF3 shRNA (IRF3 Human)
UseLentiviralAvailable sinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNR4A1.1.0-gDNA
Plasmid#112391PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor NR4A1DepositorAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmStayGold_mStayGold_I3
Plasmid#239339PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with two copies of mStayGold in mammalian cells. Assembles into nanocages tagged with 120 FPs.DepositorInsertI3-01
TagsmStayGoldExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Shank2-GFP KI
Plasmid#131496PurposeEndogenous tagging of Shank2: C-terminal (amino acid position: STOP codon)DepositorAvailable sinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
RpH-ILV-3xALFA
Plasmid#225135PurposeRpH-ILV probe strongly colocalises with lysosomal markers.DepositorInsertTMEM192 (TMEM192 Human)
ExpressionMammalianAvailable sinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only