-
Plasmid#72343PurposeMammalian expression of secreted mMBP-fused proteins with C-terminal 6His-tag/Strep-tag II/HA-tagDepositorTypeEmpty backboneUseTags6His-tag, HA-tag, Strep-tag II, and mMBPExpressionMammalianMutationPromoterCMV enhancer + chicken beta-actin promoterAvailable sinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pET-15b-hAR-663-919
Plasmid#89083Purposebacterial expression of human androgen receptor ligand bindng domain amino acid residues 663-919 with histidine tagDepositorInserthAR ligand binding domain (AR Human)
UseTagsHisExpressionBacterialMutationaa 663-919PromoterT7Available sinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-short Cre-on G/W
Plasmid#86949PurposeGateway destination transfer plasmid for making AAV. Contains a DIO cassette for cre-induction. For introducing large constructs into AAVDepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_GWRev_Dest
Plasmid#86954PurposeGateway destination transfer plasmid for making AAV. Contains a DIO cassette for cre-induction. With cre, insert will flip backwards, causing it to turn off (cre-off)DepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
UPB-esophagus (UPB5)
Plasmid#180783PurposeUnique Projection Barcode (UPB5)-Esophagus for Projection-seqDepositorInserthM3Dq ( partial ) (CHRM3 Human)
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_GFP_Luciferase
Plasmid#155079PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRB051_LEU2
Plasmid#196993PurposeBig-IN Payload yeast assembly vector. Encodes LEU2 yeast selectable marker and components for bacterial copy number induction. Contains a mammalian transient (backbone) GFP-T2A-BSD selection cassette.DepositorTypeEmpty backboneUseCre/Lox, Mouse Targeting, and Synthetic Biology ;…TagsExpressionMammalianMutationPromoterAvailable sinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-LPPRC-mod
Plasmid#48168Purposecontains Renilla Luciferase gene preceded by a mutated (ATG --> TTG) upstream open reading frame elementDepositorInsertLRPPRC leucine rich pentatricopeptide repeat containing (LRPPRC Human)
UseLuciferaseTagsExpressionMutationA/T mutation in the ATG of the uORFPromoterAvailable sinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDest27-mBIN1+17
Plasmid#61096PurposeExpress N-terminal GST tagged-mouse BIN1+17 in mammalian cellsDepositorInsertmouse BIN1 with exon 17, excluding exon 7, 11, 13-16
UseTagsGSTExpressionMammalianMutationPromoterCMVAvailable sinceJan. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS-mTagRFP-TUBA1B
Plasmid#62850PurposeDonor vector for gene editing at human TUBA1B locusDepositorInsertmTagRFP-TUBA1B (TUBA1B Synthetic, Human)
UseYeast-e.coli shuttle vectorTagsExpressionMutationPromoterAvailable sinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV Reep4-V5
Plasmid#175120PurposeLentiviral expression of mouse Reep4-V5DepositorInsertReep4 (Reep4 Mouse)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterAvailable sinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc MOB1 T12/35A
Plasmid#47938Purposeexpresses Myc tagged human MOB1 containing T12A and T35A mutationsDepositorInsertMOB1A (MOB1A Human)
UseTagsMycExpressionMammalianMutationT12A and T35APromoterCMVAvailable sinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2-actinb-kcnj13-EGFP
Plasmid#164940PurposeTol2 construct: actinb (actb2) promoter driven zebrafish kcnj13 fused with EGFP at the C terminusDepositorInsertkcnj13 (kcnj13 Zebrafish)
UseTol2 transposon destination vectorTagsEGFPExpressionMutationStop codon deletedPromoteractinb (actb2) promoterAvailable sinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_1
Plasmid#155059PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_1
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV V5-nurim
Plasmid#175110PurposeLentiviral expression of V5-tagged mouse NrmDepositorInsertNrm (Nrm Mouse)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterAvailable sinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_3
Plasmid#155075PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_Lb
Plasmid#155054PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only