-
Plasmid#216155PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. Very bright and decent dynamic range (>10-fold), slightly leaky. It uses a single intron. [Code 'B12'].DepositorInsertmScarlet with cryptic splice site and C-terminal FLAG tag
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
M13cp-dg3 hp
Plasmid#218095PurposeHelper plasmid that allows phagemid production upon complementation with a phagemid expressing pIIIDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a 6xHis PreScission SARS-CoV-2 nsp13
Plasmid#159390PurposeExpresses the SARS-CoV-2 nsp13 protein with an N-terminal His6 tag followed by an HRV 3C/PreScission cleavage site.DepositorInsertN-terminal His tag PreScission SARS-CoV-2 nsp13, optimized for insect cell expression
UseTagsHis6 tagExpressionBacterialMutationPromoterT7Available sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-sumo-NSP12 (SARS-CoV-2)
Plasmid#159107PurposeThe SARS-CoV-2 NSP12 coding sequence was cloned into a modified pRSFDuet-1 vector (Novagen) bearing an N-terminal His6-SUMO-tag which is cleavable by the ubiquitin-like protease (ULP1).DepositorInsertNSP12
UseTagsHis-SUMO tagExpressionBacterialMutationNonePromoterT7Available sinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBK2044-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223164Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBOB-CAG-SARS-CoV2-Spike-HA
Plasmid#141347Purpose3. Generation lentiviral vector expressing the codon optimized SARS-CoV2 Spike Glycoprotein ORF with a C-terminal HA tag generated by Junko Ogawa & Gerald M PaoDepositorHas ServiceLentiviral PrepInsertSARS-CoV2 Spike Glycoprotein (S SARS-CoV2 hCoV19_USA EPI_ISL_414366 (GISAID))
UseLentiviralTagsHAExpressionMutationresynthesized with human codon optimization nucle…PromoterCAGAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiTet-LDLR-mCherry BlastR
Plasmid#186739PurposeDox inducible LDLR coding sequence expression construct cloned into a lentiviral backbone containing a blasticidin resistance geneDepositorInsertLDLR (LDLR Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE311B
Plasmid#120418PurposeExpresses Lambda Beta and a dominant negative MutL E32K allele, controlled by XylS-Pm expression system for high precision and efficient MAGE experiments at 37°C. RSF1010 Ori; Broad host-range; KanRDepositorArticleInsertsMutL E32K
Lambda Beta
XylS
UseTagsExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…PromoterPmAvailable sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMV9 lenti pEF-rTetR(SE-G72P)-3XFLAG-NOTC2(Notch)-T2A-mCherry-BSD-WPRE
Plasmid#188755PurposeLentiviral backbone containing NOTC2 Notch domain as a fusion with rTetR(SE-G72P)-3XFLAGDepositorArticleInsertNOTC2 Notch (NOTCH2 Human)
UseLentiviralTagsrTetR(SE-G72P)-3xFLAGExpressionMammalianMutationPromoterpEF1aAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBOB-CAG-SARS-CoV2-Spike D614G-HA
Plasmid#158761Purpose3rd Generation lentiviral vector expressing the codon optimized SARS-CoV2 Spike Glycoprotein D614G high infectivity mutant with a C-terminal HA tag generated by Junko Ogawa & Gerald M PaoDepositorInsertSARS-CoV2 Spike Glycoprotein (S SARS-CoV2 hCoV19_USA EPI_ISL_414366 (GISAID))
UseLentiviralTagsHAExpressionMammalianMutationSpike D614GPromoterCAGAvailable sinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRDA_122
Plasmid#208095PurposePerturb-Seq lentiviral gRNA expression vector with a 3' appended capture sequence to enable direct capture of CRISPR gRNAs for scRNA-seqDepositorInsertPuromycin resistance
UseCRISPR and LentiviralTagsExpressionMutationPromoterEF1aAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV(gRNA)-CMV-eGFP-U6(sgCTG)
Plasmid#216732PurposeContains a eGFP gene along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Used with the HD iPSC-derived astrocytesDepositorArticleInsertsgCTG lentiviral guide RNA with eGFP tag
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pExp-RBD-CHis
Plasmid#195002PurposeProduction of SARS-CoV2 receptor binding domain in E. coli with C-terminal Avi-tagDepositorInsertRBD (S SARS-CoV-2)
UseTagsHis8ExpressionBacterialMutationPromoterT7lacAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF153_Gag-Pol
Plasmid#225961PurposeCMV-Intron-GagPol (FMLV). Expresses FMLV (Friend Murine Leukemia Virus) Gag-Pol for VLP production.DepositorInsertCMV-Intron-GagPol (FMLV)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF142_U6-sgRNA
Plasmid#225960PurposeU6-sgRNA (recipient). Expresses U6-sgRNA (recipient) for VLP production. This is a recipient vector for cloning of specific SpyCas9 sgRNAs.DepositorInsertU6-sgRNA (recipient)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF140_Gag-SpyCas9-NLS
Plasmid#225959PurposeCMV-Intron-Gag-SpyCas9-NLS. Expresses Gag-SpyCas9-NLS for VLP production.DepositorInsertCMV-Intron-Gag-SpyCas9-NLS
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-H3.3(WT)-3AID-HA-2A-mTurquoiseBSD
Plasmid#225701PurposeLentiviral expression of AID degron tagged Wildtype H3.3 and mTurquoise fused BlasticidinRDepositorUseLentiviralTags3xAID HA and T2A-mTurquoiseExpressionMammalianMutationPromoterAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET3a.H2B-K120C
Plasmid#224706PurposeExpresses Human H2B K120C mutant in bacterial cells for fluorescent labelling of histone octamersDepositorInsertH2B-K120C (H2B Human)
UseTagsExpressionBacterialMutationK120CPromoterT7Available sinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only