We narrowed to 3,476 results for: biorxiv
-
Plasmid#240713PurposepLAM12 vector backbone containing Ebu1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertEbu1 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-elavl3-WHaloCaMP1a-EGFP
Plasmid#205311PurposeExpression of WHaloCaMP1a-EGFP in zebrafish from the elavl3 promoter (pan-neuronal expression)DepositorInsertWHaloCaMP1a-EGFP
UseZebrafish expressionAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRhobin2-SEC61B-IRES-NLS-mTagBFP-2xNLS
Plasmid#239024PurposeCo-overexpression of Rhobin2-SEC61B fusion protein and NLS-mTagBFP-2xNLS as a nuclear labeling markerDepositorInsertRhobin2-SEC61B (SEC61B Human, Synthetic)
TagsTagBFPExpressionMammalianPromoterCMV promoterAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ7
Plasmid#223180PurposepORI28 derivative with lacZ and upp gene inserted into the backbone; for generating gene-specific knockouts.DepositorTypeEmpty backboneUseChromosomal integrationAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
hnRNPA1_D262V-FLAG-IRES-eGFP
Plasmid#234620PurposeMammalian expression of full-length hnRNPA1 D262V with C-terminal FLAG tag co-expressing with eGFP via IRES sequenceDepositorInserthnRNPA1 D262V (HNRNPA1 Human)
TagsFLAGExpressionMammalianMutationFamillial ALS mutation D262V, C-terminal FLAG tag…PromoterCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSET-WHaloCaMP1a-EGFP
Plasmid#205303PurposeExpression of WHaloCaMP1a-EGFP fusion in E. coliDepositorInsertWHaloCaMP1a-EGFP
ExpressionBacterialAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCKC775
Plasmid#226626PurposepiggyBAC 7xTCF-LEF hCas9-T2A-A/T-biased2DepositorInsertsUseSynthetic BiologyExpressionMammalianPromoter7xTCF-LEF and EF1aAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCKC764
Plasmid#226625PurposepiggyBAC pCAG-hCas9-T2A-Unbiased3DepositorInsertsCAG promoter, SpCas9, T2A, Unbiased3 variant of TdT (DNTT S. pyogenes, Human, Chicken)
EF1a promoter, blasticidin resistance
UseSynthetic BiologyExpressionMammalianPromoterCMV and EF1aAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCKC776
Plasmid#226627PurposepiggyBAC 4xHRE YB_TATA hCas9-T2A-G/C-biased1DepositorInserts4x HRE_YB TATA, SpCas9, oxygen-dependent degron, T2A, G/C-biased1 variant of TdT (DNTT S. pyogenes, Human)
EF1a promoter, mCherry
UseSynthetic BiologyTagsoxygen dependent degron (ODD)ExpressionMammalianPromoter4xHRE_YB TATA and EF1aAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTOR-F2108L_CD19-CAR-28z-2A-EGFP_AAV6_Donor
Plasmid#211904PurposeVector for AAV6 donor production. Targeted CD19-CAR-28z-2A-EGFP transgene integration to the MTOR locus with the dominant rapamycin resistance MTOR-F2108L mutation via homology-directed repair.DepositorInsertCD19-CAR-28z-2A-EGFP
UseAAVExpressionMammalianPromoterhPGK1Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR2_DAZL-T2A-mGreenLantern-PuroTK
Plasmid#222917PurposeHomology directed repair template for knocking in mGreenLantern reporter to DAZL.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
SynNotch TMD/Gal4-VP64 ICD (MTK 3b) (pAN1031)
Plasmid#194222PurposeMammalian Toolkit part 3b encoding SynNotch and GAL4-VP64 to be used in designing modular receptorsDepositorInsertSynNotch-GAL4 DBD-VP64 AD
UseSynthetic BiologyPromoterNoneAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1303-AAV-EFSNC-dCjCas9-MECP2(204-310)
Plasmid#223148PurposeExpression of truncated MECP2 with dCjCas9 and empty gRNA scaffoldDepositorInsertMECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310PromoterEF1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV-FLAG-TurboID-mutKIR-SQSTM1
Plasmid#223719PurposeExpresses FLAG-TurboID-mutKIR-SQSTM1DepositorInsertSQSTM1 (SQSTM1 Human)
UseLentiviralTagsTurboIDExpressionMammalianMutationMutation 347-DPSTGE-352 to 347-APSAAA-352PromoterSFFVAvailable SinceAug. 28, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSBL_DK202
Plasmid#156426PurposeMammalian expression of 3a delta N(aa 42-275)-EGFP with CMV promoter, can be used for transfection or used to generate bacmids for baculoviral infection of mammalian cellsDepositorInsertSARS-CoV-2 3a protein (aa 42-275)
TagsEGFP-HisExpressionMammalianMutationaa 42-275PromoterCMVAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-SARS-CoV-2 SL1 alone-Luciferase
Plasmid#191482PurposeLuciferase reporter for SARS-CoV-2 5' UTR SL1 aloneDepositorInsertSARS-CoV-2 5' UTR SL1 alone
UseLentiviral and LuciferaseMutationContains only the stem-loop1 region of SARS-CoV-2…Available SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2T CAG dCas9-10XGcn4-P2A-mCherry BlastR
Plasmid#186745PurposedCas9-10XGcn4-P2A-mCherry expression constructDepositorInsertCas9-10XGcn4-P2A-mCherry
UseCRISPRExpressionMammalianAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only