We narrowed to 3,413 results for: biorxiv
-
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Tsp1
Plasmid#240712PurposepLAM12 vector backbone containing Tsp1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertTsp11 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Kva1
Plasmid#240709PurposepLAM12 vector backbone containing Kva1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertKva1 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Hcl1
Plasmid#240714PurposepLAM12 vector backbone containing Hcl1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertHcl1 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Eas1
Plasmid#240710PurposepLAM12 vector backbone containing Eas1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertEas1 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010lac-Kva1
Plasmid#240695PurposeRSF1010 origin of replication plasmid containing Kva1 recombitron with a SapI flanked stuffer in the ncRNA expressed by lac promoterDepositorInsertKva1 RT,Kva1 ncRNA, Beta and EcSSB
ExpressionBacterialMutationWTAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010lac-Tsp1
Plasmid#240698PurposeRSF1010 origin of replication plasmid containing Tsp1 recombitron with a SapI flanked stuffer in the ncRNA expressed by lac promoterDepositorInsertTsp1 RT, Tsp1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010lac-Hcl1
Plasmid#240700PurposeRSF1010 origin of replication plasmid containing Hcl recombitron with a SapI flanked stuffer in the ncRNA expressed by lac promoterDepositorInsertHcl1 RT, Hcl1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010lac-Eco2
Plasmid#240692PurposeRSF1010 origin of replication plasmid containing Eco2 recombitron with a SapI flanked stuffer in the ncRNA expressed by lac promoterDepositorInsertEco2 RT, Eco2 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Csp1
Plasmid#240711PurposepLAM12 vector backbone containing Csp1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertCsp1 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Abe1
Plasmid#240708PurposepLAM12 vector backbone containing Abe1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertAbe1 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Ban1
Plasmid#240707PurposepLAM12 vector backbone containing Ban1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertBan1 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010lac-Eas1
Plasmid#240696PurposeRSF1010 origin of replication plasmid containing Eas1 recombitron with a SapI flanked stuffer in the ncRNA expressed by lac promoterDepositorInsertEas1 RT, Eas1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010lac-Ban1
Plasmid#240693PurposeRSF1010 origin of replication plasmid containing Ban1 recombitron with a SapI flanked stuffer in the ncRNA expressed by lac promoterDepositorInsertBan1 RT, Ban1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010lac-Ebu1
Plasmid#240699PurposeRSF1010 origin of replication plasmid containing Ebu1 recombitron with a SapI flanked stuffer in the ncRNA expressed by lac promoterDepositorInsertEbu1 RT, Ebu1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only