We narrowed to 3,362 results for: biorxiv
-
Plasmid#250344PurposeExpressing human ATG13 (1-230) with H214D/F215D mutationsDepositorInsertATG13 (ATG13 Human)
TagsGFPExpressionMammalianMutationonly amino acids 1-230 with H214D and F215D muta…PromoterCAGAvailable SinceMarch 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGenLenti murine CD300LF
Plasmid#235668Purpose3rd Generation lentiviral vector for expression of murine CD300LF. Murine CD300LF is the receptor for murine norovirus, and expression confers susceptibility to this virus. Puromycin resistance.DepositorAvailable SinceMarch 24, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPig-hEF1a-Cry2PHR-LRP6c-Puro-Blind
Plasmid#249712PurposeExpresses optogenetic LRP6 in mammalian cells; no fluorescent proteins. Plasmid contains a puromycin selection marker.DepositorAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
M3-dCAS9-DNMT3A-DNMT3A (dCas9-3A-3A)
Plasmid#218776PurposeExpresses dCAS9-DNMT3A-DNMT3A fusion protein and double marker GFP-T2A-Puro under independent promotersDepositorInsertsM3-dCAS9-DNMT3A-DNMT3A (dCas9-3A-3A)
GFP-T2A-Puro
UseCRISPRExpressionMammalianAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
M3-dCAS9-DNMT3A-KRAB (dCas9-3A-KRAB)
Plasmid#218781PurposeExpresses dCAS9-DNMT3A-KRAB fusion protein and double marker GFP-T2A-Puro under independent promotersDepositorInsertsM3-dCAS9-DNMT3A-DNMT3L (dCas9-3A-3L)
GFP-T2A-Puro
UseCRISPRExpressionMammalianAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
M3-dCAS9-mutDNMT3A(R882H)(dCas9-mut3A)
Plasmid#218788PurposeExpresses dCAS9- R882H Mutated DNMT3A fusion protein and double marker GFP-T2A-Puro under independent promotersDepositorInsertsM3-dCAS9-MutDNMT3A (dCas9-Mut3A (R882H))
GFP-T2A-Puro
UseCRISPRExpressionMammalianAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
CVS-N2c-RVdG-MCP:oScarlet:KASH-6xMBS
Plasmid#231011PurposeCVS N2c RVdG genome plasmid. Utilizes MS2 tagging to deliver the MCP:oScarlet:KASH transcript to the outer nuclear membrane. Insert high complexity barcode between SacII RE sites distal to 6xMBS site.DepositorInsertMCP-oScarlet-KASH-6xMBS-SacIIMCS
UseNeurotropic virusTagsKASH and MCPAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
CVS-N2c-RVdG-MCP:oScarlet-KASH_NoMBS
Plasmid#231014PurposeCVS N2c RVdG genome plasmid, utilized to generate negative control virus to benchmark the utility of MS2 tagging for capture of barcodes using snRNA-seq.DepositorInsertMCP-oScarlet-KASH
UseNeurotropic virusTagsKASH and MCPAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-CDKL5(isoform-2)
Plasmid#245901PurposeMammalian expression of CDKL5 isoform2 (1-1030) with N-terminal GFPDepositorAvailable SinceNov. 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
GFP-CDKL5(kinase)
Plasmid#245902PurposeMammalian expression of CDKL5 kinase domain (1-311) with N-terminal GFPDepositorAvailable SinceNov. 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
PLCe EF-C
Plasmid#244968PurposeExpresses N-terminal truncation of phospholipase Ce in mammalian cells (EF hands 1/2- Cterminus)DepositorInsertphospholipase C epsilon (Plce1 Rat)
TagsFLAGExpressionMammalianMutationN-terminal truncation that removes residues 1-103…PromoterCMVAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLCe PH-C
Plasmid#244967PurposeExpresses N-terminal truncation of phospholipase Ce in mammalian cells (PH domain - C-terminus)DepositorInsertphospholipase C epsilon (Plce1 Rat)
TagsFLAGExpressionMammalianMutationN-terminal truncation that removes residues 1-836PromoterCMVAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET24+ CUL5(1-384)
Plasmid#246504PurposeRecombinant protein expression of CUL5(1-384)DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA1
Plasmid#166889PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Nsp3(1-111)
Plasmid#242947PurposeGFP and the Ubl1 domain of the SARS-CoV-2 Nsp3 protein (aa 1-111)DepositorAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only